Detected as a riboswitch by 8 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA085498 Similarity: 0.974 Similarity: 0.973 Similarity: 0.973
UTR: 5HSAA085498
Gene: PSMB1
MFE: -32.712
ENS: 0.854
Length: 112.
Predicted Ligands:
TPP - 18/20
zmp-ztp - 1/20
methionine - 1/20
 RS: URS0000D7AE44_1797846
MFE: -42.042
Ligand: TPP
Species: Deltaproteobacteria bacterium RBG_16_64_85 TPP riboswitch (THI element)
 RS: URS0000C5D32A_1566387
MFE: -44.126
Ligand: TPP
Species: Mesorhizobium sp. UASWS1009 TPP riboswitch (THI element)
 RS: URS0000D80260_1897028
MFE: -40.010
Ligand: TPP
Species: Firmicutes bacterium CAG:129_59_24 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA085498 URS0000D7AE44_1797846 URS0000C5D32A_1566387 URS0000D80260_1897028
Length 112. 113. 112. 112.
Similarity - 0.974 0.973 0.973
Ensemble Norm 0.854 - - -
MFE -32.712 -42.042 -44.126 -40.010
Ligands - TPP TPP TPP
Gene PSMB1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 5.009 5.001 10.001
Length SE - 1. 0. 0.
Lev Distance - 32. 34. 32.
UBS 9. 9. 9. 7.
BS 0. 0. 0. 1.
ILL 3. 2. 3. 3.
ILR 2. 2. 2. 2.
H 4. 4. 4. 4.
BL 1. 3. 2. 0.
BR 3. 3. 1. 1.
UN 0.107 0.204 0.071 0.134

Sequences

Field Description
UTR seq + 25 gagaagccggaaguggcguaacguccggucaaggcagccaucucgccgugagacagcaagugucggauccgcaggcgcagccgugcgATGTTGTCCTCTACAGCCATGTATT
UTR dot + 25 …..((((((.((……)).))))))…((((((..((((…..))))..))…))))((((..(((..((((….)))).))).))))..((((….))))..
RS 1 seq CAUAACCGCCAGGGGUGCUAUUCGCUGAGAGCCCGGGGAGGGUUUCCGCCCAGGGCAACCCGUCGAACCUGAUCCGGGUAAUACCGGCGCAGGGAGCGUGGCCUUUCACGAAC
RS 1 dot ………(((.((……)).)))…((((.(((.((….)).))).))))………..((((..((((……))))..))))(..(((((….)))))..)
RS 2 seq GCGCCUCACCAGGGGAGUCCCGGCAAGGGGCUGAGAUACUGCUAUAGCGCGCAGUGACCCGUUGAACCUGAUCCAGUUCAUACUGGCGUAGGGACGGUGCGAGGCUUCGCGG
RS 2 dot ((.(((..((.(((….)))))..))).))…..((((((……..))))))..(((((…((((..(((((….)))))..)))))))))(((((….))))).
RS 3 seq CGUAUAUGCAAGGGGCGCUGGCGCAAGCCGGCUGUGAUGCGGCGUAUCGCCGUCGCUGUCCCUCAGACCUGAUCCGGGUAAUGCCGGCGUAGGAAUGCAAAGAGUAUCUUGC
RS 3 dot ……….((((((((((((….)))))).(((..((((((…))))))))).))))))((..((((..((((……))))..))))..))..((((…))))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table