Detected as a riboswitch by 14 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA085499 Similarity: 0.970 Similarity: 0.969 Similarity: 0.965
UTR: 5HSAA085499
Gene: PSMB1_0
MFE: -35.491
ENS: 0.899
Length: 124.
Predicted Ligands:
methionine - 8/20
SAM - 7/20
TPP - 2/20
 RS: URS0000BE3845_1587522
MFE: -56.267
Ligand: methionine
Species: Rhodococcus sp. MEB064 S-adenosyl methionine (SAM) riboswitch,
 RS: URS0000D669B4_384765
MFE: -43.106
Ligand: SAM
Species: Labrenzia aggregata IAM 12614 SAM-I/IV variant riboswitch
 RS: URS0000D9D635_197461
MFE: -40.929
Ligand: SAM
Species: Nesiotobacter exalbescens SAM-I/IV variant riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA085499 URS0000BE3845_1587522 URS0000D669B4_384765 URS0000D9D635_197461
Length 124. 125. 123. 123.
Similarity - 0.970 0.969 0.965
Ensemble Norm 0.899 - - -
MFE -35.491 -56.267 -43.106 -40.929
Ligands - methionine SAM SAM
Gene PSMB1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 11.001 15.011 14.017
Length SE - 1. 1. 1.
Lev Distance - 34. 34. 39.
UBS 11. 10. 9. 9.
BS 0. 0. 0. 0.
ILL 2. 1. 1. 0.
ILR 0. 0. 0. 0.
H 6. 5. 5. 5.
BL 2. 4. 2. 1.
BR 5. 3. 2. 3.
UN 0.081 0.112 0.187 0.211

Sequences

Field Description
UTR seq + 25 agcgaacuucaggagaagccggaaguggcguaacguccggucaaggcagccaucucgccgugagacagcaagugucggauccgcaggcgcagccgugcgATGTTGTCCTCTACAGCCATGTATT
UTR dot + 25 ……((((….))))(((((.((……)).)))))(((.(((((….)).))).)))((((…..))))((((..(((..((((….)))).))).))))..((((….))))..
RS 1 seq GGUCAUGAGCGCCAGCAUCGAGCCCCGGCUUGCUGGCCGGCAACCCUCCAACCGCGGUGGGGUGCCCCGGGUGAUGACCGGGUUACUCGGUCCGUGAUCGUGCGGAGCGAGAGCAAGCGCGGGCC
RS 1 dot ……….(((((((…(((….)))))))))).((((.(((.((……)).))).))))((((…….))))(((.((((.(((((……))))).)))))))..((….)).
RS 2 seq CGCCAUCAUCAAGAGAAGGGCUGGCGCCCUCGCCAACCUGCCGUCCGGGCAAGGUGGUUUCCGCAACAGGGAUGCGGCCGGUCAGACCCUCUACCGAGGUUUUCCGGCAACGAAGCGGUUAAU
RS 2 dot …………….(((((….))))).(((.(((((((…..)))).))))))..(((((…….)))))((((..(((.((((….))))))).)))).(((……)))…
RS 3 seq AAACAUCAUCAAGAGAAGGGCUGGCGCCCUCGCCAACCUGCCAACCGGGCAAGGUGGUUUCCGCAUUUAGGGAUGUGGCUGACAUCAGGUUUUUCUGGAUGUUCGGCAACCAAGCGGUGUUAC
RS 3 dot …………….(((((….))))).(((.(((((((…..)))).))))))…((((((….))))))((((((((((((….)))).)))).)))).(((….)))…..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table