Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA085508 Similarity: 0.977 Similarity: 0.976 Similarity: 0.975
UTR: 5HSAA085508
Gene: PSMB3
MFE: -30.643
ENS: 0.984
Length: 103.
Predicted Ligands:
TPP - 9/20
glycine - 4/20
homocysteine - 3/20
 RS: URS0000DA746E_1797552
MFE: -28.027
Ligand: homocysteine
Species: Burkholderiales bacterium RIFCSPHIGHO2_01_FULL_63_240 S-adenosyl-L-homocysteine riboswitch
 RS: URS0000D67D58_12908
MFE: -26.799
Ligand: GMP
Species: unclassified sequences c-di-GMP-II-AAA riboswitch
 RS: URS0000C340D6_1284
MFE: -23.430
Ligand: Mn2+
Species: Staphylococcus hyicus yybP-ykoY manganese riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA085508 URS0000DA746E_1797552 URS0000D67D58_12908 URS0000C340D6_1284
Length 103. 102. 102. 104.
Similarity - 0.977 0.976 0.975
Ensemble Norm 0.984 - - -
MFE -30.643 -28.027 -26.799 -23.430
Ligands - homocysteine GMP Mn2+
Gene PSMB3 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6. 11.006 8.001
Length SE - 1. 1. 1.
Lev Distance - 27. 27. 29.
UBS 8. 8. 6. 8.
BS 0. 0. 0. 0.
ILL 3. 2. 2. 2.
ILR 0. 2. 1. 2.
H 2. 2. 1. 3.
BL 2. 2. 2. 3.
BR 3. 2. 1. 2.
UN 0.165 0.186 0.088 0.135

Sequences

Field Description
UTR seq + 25 gagcgguugcgcagugaaggcuagacccgguuuacuggaauugcucuggcgaucgagggguccuaguacaccgcaaucATGTCTATTATGTCCTATAACGGAG
UTR dot + 25 ….(((((((..(((…(((((((((……((.((.((((….)))))).))))))).)))).))))))))))…………(((……))).
RS 1 seq ACUUUCGAGGAGCGUUGCAAGGCCCGUCCCGUCGUUGAACACGGCGCGAACCGCUGGCCCCAGGCUCGAAAGCUUCUCCUUUUGCAACGGCGCUCACCCGCA
RS 1 dot .(((((…((((.(((…((((((((.((((((…..)))))).))..))..)))).))))))))))))……………..(((……))).
RS 2 seq AAGCAAGACGGCGGCAAUGAUCCAAUGCUUUUGUGGUGGUCGCUCAUCCCCUUUGUGGGUGCGAGCAUUGGGUAGCCAAUAGCGAAACCAGCCUCUUUUCAA
RS 2 dot ….((((.((((((….(((((((((((……..(.(((((((…….))))))))))))))))))).)))………….)))))))…..
RS 3 seq ACAGCUUUGUCAGAGGGGAGUAACUUGUUUAACGUUUAUCGUUAAAAACGUUUUGUCGUCAUUACGAAGAAUUAUCUUCCGGUAAAACGGGCAAUAUUUUUGCU
RS 3 dot ….((((((..((.((.((.(((…(((((((…..)))))))…))))).)).))…))))))………(((……)))((((…..)))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table