Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA085509 Similarity: 0.981 Similarity: 0.980 Similarity: 0.980
UTR: 5HSAA085509
Gene: PSMB3_0
MFE: -20.663
ENS: 0.987
Length: 94.
Predicted Ligands:
homocysteine - 9/20
TPP - 4/20
guanidine - 3/20
RS: URS0000C293C3_1658672
MFE: -35.023
Ligand: homocysteine
Species: Ottowia sp. oral taxon 894 S-adenosyl-L-homocysteine riboswitch
RS: URS0000C209FE_1843690
MFE: -32.917
Ligand: homocysteine
Species: Pseudomonas sp. 21C1 S-adenosyl-L-homocysteine riboswitch
RS: URS0000D9D511_211114
MFE: -38.835
Ligand: homocysteine
Species: Kibdelosporangium albatum S-adenosyl-L-homocysteine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA085509 URS0000C293C3_1658672 URS0000C209FE_1843690 URS0000D9D511_211114
Length 94. 92. 94. 96.
Similarity - 0.981 0.980 0.980
Ensemble Norm 0.987 - - -
MFE -20.663 -35.023 -32.917 -38.835
Ligands - homocysteine homocysteine homocysteine
Gene PSMB3 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4.045 2.019 3.
Length SE - 4. 0. 4.
Lev Distance - 20. 26. 21.
UBS 7. 6. 6. 6.
BS 0. 0. 0. 0.
ILL 2. 1. 2. 2.
ILR 1. 1. 1. 1.
H 3. 2. 2. 2.
BL 2. 3. 2. 2.
BR 0. 0. 0. 1.
UN 0.223 0.011 0.085 0.229

Sequences

Field Description
UTR seq + 25 gcgguugcgcagugaaggcuagacccgguuuacuggaauugcucuggcgaucgagggauccuaucuauuATGTCTATTATGTCCTATAACGGAG
UTR dot + 25 .(((((((.(((….(((.((..((((….))))..)))))))))))))))(((…)))……………….(((……))).
RS 1 seq CCCUUCGAGGAGCGUUGCAUCCCCCGCCUGUUGGCGCAGGGGUCAGGCUCGAAGGGGCGGUUUCUCCCCCUUCGCAACGACGCUCACCCGCU
RS 1 dot ((((((…((((.(((.(((((.((((….))))..))))))))))))))))))((((………………………)))).
RS 2 seq CCGUCCGAGGGGCGCUGCAGCAAACCCUGUGCAACAGGACUUUGUCAGGCUCGGAUGGGGCGUUAACCAUACGCAUCAACGGCGCCCAUUCGAC
RS 2 dot .(((((((…((.(((..(((((.(((((…)))))..)))))))))))))))))(((((((…………….)))))))…….
RS 3 seq CGGGUCGAGAGGCGCUGCAACGGGCUGCUGGGACCACCACCCCAGCCCGCCACGCUCGACCCGUUUUCCGAUCCGCAACAAGGGCGCCUCCCACUU
RS 3 dot ((((((((…(((.((…(((((((.(((…..)))…))))))).)))))))))))))………………(((…..)))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table