Detected as a riboswitch by 16 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA085510 Similarity: 0.965 Similarity: 0.961 Similarity: 0.960
UTR: 5HSAA085510
Gene: PSMB3_1
MFE: -34.263
ENS: 0.901
Length: 139.
Predicted Ligands:
cobalamin - 8/20
FMN - 3/20
homocysteine - 3/20
 RS: URS0000B67CA3_42444
MFE: -44.650
Ligand: FMN
Species: Marinovum algicola FMN
 RS: URS0000C10C2C_1796616
MFE: -35.355
Ligand: FMN
Species: Blautia sp. YL58 FMN riboswitch (RFN element)
 RS: URS000232A80F_66430
MFE: -56.353
Ligand: cobalamin
Species: Streptomyces roseus Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA085510 URS0000B67CA3_42444 URS0000C10C2C_1796616 URS000232A80F_66430
Length 139. 139. 138. 139.
Similarity - 0.965 0.961 0.960
Ensemble Norm 0.901 - - -
MFE -34.263 -44.650 -35.355 -56.353
Ligands - FMN FMN cobalamin
Gene PSMB3 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 5. 6.015 14.
Length SE - 0. 1. 0.
Lev Distance - 44. 48. 46.
UBS 12. 12. 12. 15.
BS 0. 0. 0. 0.
ILL 0. 0. 2. 1.
ILR 2. 3. 2. 4.
H 4. 4. 3. 4.
BL 6. 4. 6. 6.
BR 4. 4. 5. 4.
UN 0.036 0.050 0.159 0.043

Sequences

Field Description
UTR seq + 25 gaguccgccuaucagccaaugaagagacagcagugagagcgguugcgcagugaaggcuagacccgguuuacuggaauugcucuggcgaucgagggauccuaguacaccgcaaucATGTCTATTATGTCCTATAACGGAG
UTR dot + 25 (.(((.((((.(((((((((…………………)))).))..)))))))..))))((((.((((((.(((.(((……..))).))).)))))).))))….((((…..))))(((……))).
RS 1 seq UCGCGUUCUCAGGGCGGGGUGAAAUUCCCCACCGGCGGUCAUAGCCCGCGAGCGCCUUUCGGGUCAGUCCCGCAAGGGUCAGCAGAUACCGGUGGAAUUCCGGAGCCGACGGUCAAAGUCCGGAUGGAAGAGAACCAGC
RS 1 dot ..((((((.(.((((((((…….))))………….))))).))))))((.(((((((.(((((….)))…)).))).)))).))…(((((((((…)))…..))))))(((…….)))..
RS 2 seq UGAAGUCUUUGUGGCAGGGUGUAAGUCCCUACCGAUGGUAUAGUCCAUGACCCGCUUUGGCGGCUGAGCCGGUGACUCCUUUUGUAUGAUAGGGGAAUUCCGGCACCGACGGUAUAGUCCGGAUGAGAAAAGACAUUU
RS 2 dot …((((.(((.(((.((((….(.(..((((…))))..).)….))))))).))).))))..(((((.((.((((((……..)))))).))))))).(((((……))).))…………….
RS 3 seq CGGACCCUUGAUCACUCGGGUAGCGUCCUGGGCUGCCACAUGGGGGAACCCGGUGCGAAUCCGGGGCUGACGCGCAGCGGUGUGGGACGGCAGGGGGCCGUCACCGAGCCCGAAUGCCCAUCUGGCGAGGCACACCUCA
RS 3 dot (((.((((.((((((.(((((..(.((((((….)))…))).).))))))))…))).)))))))….(((.(((.((((((((((…..)))))).))..)))))..)))((….)).((((….)))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table