Detected as a riboswitch by 19 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA085512 Similarity: 0.992 Similarity: 0.990 Similarity: 0.989
UTR: 5HSAA085512
Gene: PSMB4
MFE: -16.685
ENS: 0.915
Length: 48.
Predicted Ligands:
SAM - 10/20
preQ_1 - 8/20
unknown - 2/20
 RS: URS0000DA9B35_163877
MFE: -9.292
Ligand: preQ_1
Species: Virgibacillus necropolis PreQ1 riboswitch
 RS: URS00021EDC9D_690417
MFE: -11.692
Ligand: SAM
Species: Paracoccus sphaerophysae SAM-SAH-Weickhmann-2018 RNA
 RS: URS0000D99644_574375
MFE: -11.087
Ligand: SAM
Species: Bacillus gaemokensis SAM riboswitch (S box leader)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA085512 URS0000DA9B35_163877 URS00021EDC9D_690417 URS0000D99644_574375
Length 48. 48. 49. 48.
Similarity - 0.992 0.990 0.989
Ensemble Norm 0.915 - - -
MFE -16.685 -9.292 -11.692 -11.087
Ligands - preQ_1 SAM SAM
Gene PSMB4 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 1. 9. 1.021
Length SE - 0. 1. 0.
Lev Distance - 10. 10. 14.
UBS 2. 2. 4. 2.
BS 0. 0. 0. 0.
ILL 0. 0. 0. 1.
ILR 1. 1. 2. 1.
H 1. 1. 1. 1.
BL 0. 1. 2. 0.
BR 0. 0. 0. 0.
UN 0.229 0.229 0.245 0.375

Sequences

Field Description
UTR seq + 25 uuuuuucugcuaccgugacuaagATGGAAGCGTTTTTGGGGTCGCGGT
UTR dot + 25 ………..(((((((((((((((….))))))…)))))))))
RS 1 seq ACGGGAGAGGUUCUUAGCUUUUAACCCUCUAUAAAAAACUAAGGACAG
RS 1 dot ………((((((((.(((((……..)))))..))))))))..
RS 2 seq CCCCCACAACGGCUUCCUGGCGUGGCGCGGCCCUGAACCCAAUGGAGCA
RS 2 dot ………..(((((.(((.(((((…)))….)))))..))))).
RS 3 seq UACUUAUCCAGAGAGGUAGAGGGACUGGCCCUAUGAAACCUCAGCAGC
RS 3 dot …………(((((..((((…..))))…..)))))……

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table