Detected as a riboswitch by 19 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA085556 Similarity: 0.981 Similarity: 0.979 Similarity: 0.978
UTR: 5HSAA085556
Gene: PSMC2
MFE: -22.631
ENS: 0.955
Length: 95.
Predicted Ligands:
TPP - 6/20
glycine - 6/20
cobalamin - 2/20
 RS: URS0000ABB99D_367110
MFE: -23.146
Ligand: TPP
Species: Neurospora crassa OR74A TPP riboswitch (THI element)
 RS: URS0000C6CECF_191292
MFE: -28.963
Ligand: glycine
Species: Rhodococcus aetherivorans Glycine riboswitch
 RS: URS0000D67B68_12908
MFE: -27.136
Ligand: GMP
Species: unclassified sequences c-di-GMP-II-GAG riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA085556 URS0000ABB99D_367110 URS0000C6CECF_191292 URS0000D67B68_12908
Length 95. 94. 95. 95.
Similarity - 0.981 0.979 0.978
Ensemble Norm 0.955 - - -
MFE -22.631 -23.146 -28.963 -27.136
Ligands - TPP glycine GMP
Gene PSMC2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 1. 2.005 11.
Length SE - 1. 0. 0.
Lev Distance - 24. 27. 25.
UBS 8. 8. 8. 9.
BS 0. 0. 0. 0.
ILL 1. 1. 1. 3.
ILR 2. 2. 1. 2.
H 2. 2. 3. 3.
BL 4. 3. 4. 2.
BR 3. 3. 3. 2.
UN 0.179 0.170 0.105 0.168

Sequences

Field Description
UTR seq + 25 gaagacaccaccggaagcaaggaaggugcuguguaaucauuaaggagcggaggcuuuuggagcugcuaaaATGCCGGATTACCTCGGTGCCGATC
UTR dot + 25 ….((((((((…………))))..))))………((.((.((((…((.(.((………))).))…)))).)).))….
RS 1 seq GAUGGGCCAACUGCGGCGGUACCACGUUGGUCUGAGAAAUACCGGCGAACUUGAUCUGGAUAAUACCAGCGAAAGGAUUGGCUUCUUGGGACCC
RS 1 dot …((((((((.(.((…..)).)))))))))……..(((((.(((((…((((……))))….))).)).)))….))…..
RS 2 seq CGCCGCCGUGCGGGAGAGUUCCGGACCUGUUCCGGACGCCGAAGGAGCAGCACCUCCCCGUCAAUCUCUCAGGCAUCGAGGACCGUGCGGGCACC
RS 2 dot …((.(((.(((((.((……..)).))))).))).))…(((……)))(((((…((.(((…….)))))….)))))….
RS 3 seq AGUAUGGGUAGAGGCCGAGAAGCCCGUCCCGUUUAAGAACGUGGCACCCUAUGAGGGACGAGGCAGAGCCAGUGGUGCGACCGGCUACCGACGCG
RS 3 dot …(((((..(.(((……))))..)))))……..((.(((((((….((..(……)..)))).))))).))(((…)))…..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table