Detected as a riboswitch by 15 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA085563 Similarity: 0.889 Similarity: 0.876 Similarity: 0.874
UTR: 5HSAA085563
Gene: PSMC2_0
MFE: -77.690
ENS: 0.882
Length: 300.
Predicted Ligands:
cobalamin - 17/20
glucosamine - 2/20
FMN - 1/20
 RS: URS0002322B36_555779
MFE: -117.232
Ligand: cobalamin
Species: Desulfonatronospira thiodismutans ASO3-1 Cobalamin riboswitch
 RS: URS0002334982_1801978
MFE: -79.375
Ligand: cobalamin
Species: Planctomycetes bacterium RIFCSPHIGHO2_12_42_15 Cobalamin riboswitch
 RS: URS00023195C5_468056
MFE: -58.944
Ligand: cobalamin
Species: Flavobacterium sp. H7 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA085563 URS0002322B36_555779 URS0002334982_1801978 URS00023195C5_468056
Length 300. 298. 301. 296.
Similarity - 0.889 0.876 0.874
Ensemble Norm 0.882 - - -
MFE -77.690 -117.232 -79.375 -58.944
Ligands - cobalamin cobalamin cobalamin
Gene PSMC2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 22.011 33.005 12.
Length SE - 4. 1. 16.
Lev Distance - 131. 145. 139.
UBS 14. 17. 18. 16.
BS 0. 0. 0. 0.
ILL 3. 6. 5. 5.
ILR 2. 4. 4. 4.
H 7. 7. 6. 7.
BL 4. 4. 6. 4.
BR 4. 4. 6. 4.
UN 0.217 0.111 0.150 0.199

Sequences

Field Description
UTR seq + 25 ccaggagcgcuauacuuuuaaguaaaaaaugaaaauaccuguaugaaccaguaucgacgacuaguauauacauuugcggagaauuacguaaucaguccaaaaaccagcgugccaaagcguuuccccagggcucuguccggacucugaagcacugcauaaaggggucugucugagcccaauuuacuuccgguggggaagggaaagggaagacaccaccggaagcaaggaaggugcuguguaaucauuaaggagcggaggcuuuuggagcugcuaaaATGCCGGATTACCTCGGTGCCGATC
UTR dot + 25 …………((((….))))……………((((((.((.(((…….))).)).)))))).(((((……..)))))…………..(((((……)))))……((((((.(..((((((((……………)))))))).).))))))……((((((((((……………….))))))))))…….(((((((.((((((…….(((…(((((…))))))))………))))))..)))))))….
RS 1 seq UUAAGGACAGUCGUCUCAGGUUUUCCCCAGUCAGGGGAAAUGAAAAGGGAAUCCCGUGUAAAUCGGGAACCGGCCCGCGGCUGUGAGCGGGGACGAAAGCCGCAUUAAGCCACUCUGGACAGAAACAGGGGAAGGCGCGGCAAGCCCAGCACUCACUUCAUUUCUGUUUGUUGCUUAUAAUCAGGUUGUACUGCAAGGAGCCAACCGGUUUAACUGGCAACAAUUAGUACCUGAAGUGAGUGCUGGGCAAGUAGGACGAUCCGCAAGUCAGAAGACCUGCCUGAGACCUUAUUGGACC
RS 1 dot ….((((….))))…..(((((((…..)))))))…….((..(((((…….))))).))..(((((……..)))))…….(((((…..(((.(((((……..)))))…))))))))..(((((((((((((((((…(((.((((((((…((((.(((((..((……)).)))))))))…..)))))))).)))….))))))))))))))))).((((((…….(((.(((….))).)))…….))))))…..
RS 2 seq CAAUAGAUUACACAUACAGGUGUCUCAACAUAUCCAUUGGGACAAAAAGGGAAUCCCAGCUCCAUUUUUUAAAUGGAGAAAAGGGAACGGUACCGCCGCUGUAUUCGGUGACGAACGUUGCAGAAGCCACUAUCCUGAUUUAGUAAUUUAUCGCAGAGGACGCCGAGAGCACAGAGAAAAAAGACAAAAAAUAAUUAAUCUCUGCGUACUCUGUAUUCUGUGGUGAUUUAAAAAGGAUGGGAAGGUGCAAUCAGUAGGACGAACCGCCAGUCAGAAAACCUGCCUGUAAUAUUUUGCCGAA
RS 2 dot ………………..((((((((……..))))))))………((((..((((((((…))))))))….)))).((((…))))(((((((((….))))…)))))..(((.(((((((..(((((….(((((((((((.(((..(((.((.((((((…………………)))))).)).)))))).))))))))))).))))).)))))))…)))……….((.((((….(((.(((…..))).)))……))))))…
RS 3 seq CAUUUGCAGCCGUAUUGAGGUUGCUGUUUUUAAUUUUAAAACCGCAUUAAAAGGGAAUCAGGUGAAAGAUUGCAGAUUGCAGAUUUUAGAUUGUAACAAUCAAAAAAAUCUAAAUCGAAAAUCCAGAAUCCUGGGCUGUACCCGCAACUGUAAGCUGUCAAGCUUGUUGUUAUCUACAAAACCACUGUUCAAAAUUUUAGAAUUGAGAUUUCAGAUUUUAUCAAAUCGGAAAUCAAGAAUGGGAAGGUAAACAACAAGACGCAAGCCAGGAGACCUGCCUAUUACAUCGAGUAUCA
RS 3 dot …..((((((…….)))))).(((((…….)))))………..(.((((……..)))).).((((..(((((((.(((((…)))))…))))))).))))………((((..(((..((((…(((((…(((((….))))))))))….))))…)))..))))…………….((((((.(((((….))))).))))))…((((((.((((……………………)))).))))))………….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table