Detected as a riboswitch by 15 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA085566-0 Similarity: 0.932 Similarity: 0.929 Similarity: 0.923
UTR: 5HSAA085566-0
Gene: PSMC2_1
MFE: -67.008
ENS: 0.922
Length: 227.
Predicted Ligands:
cobalamin - 15/20
glucosamine - 3/20
FMN - 1/20
 RS: URS000049975C_1196322
MFE: -57.703
Ligand: glucosamine
Species: Clostridium sp. Maddingley MBC34-26 glmS glucosamine-6-phosphate activated ribozyme
 RS: URS0000BF52F8_1121338
MFE: -45.588
Ligand: glucosamine
Species: Clostridium tepidiprofundi DSM 19306 glmS glucosamine-6-phosphate activated ribozyme
 RS: URS0000C80B65_1618350
MFE: -63.871
Ligand: glucosamine
Species: candidate division CPR3 bacterium GW2011_GWF2_35_18 glmS glucosamine-6-phosphate activated ribozyme
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA085566-0 URS000049975C_1196322 URS0000BF52F8_1121338 URS0000C80B65_1618350
Length 227. 227. 225. 227.
Similarity - 0.932 0.929 0.923
Ensemble Norm 0.922 - - -
MFE -67.008 -57.703 -45.588 -63.871
Ligands - glucosamine glucosamine glucosamine
Gene PSMC2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 8.001 7.001 14.005
Length SE - 0. 4. 0.
Lev Distance - 88. 85. 98.
UBS 10. 11. 12. 13.
BS 0. 2. 0. 1.
ILL 3. 4. 4. 2.
ILR 2. 3. 3. 3.
H 5. 5. 5. 5.
BL 2. 2. 1. 3.
BR 2. 1. 2. 3.
UN 0.189 0.163 0.156 0.119

Sequences

Field Description
UTR seq + 25 uuuccuucucacagguaaucaguccaaaaaccagcgugccaaagcguuuccccagggcucuguccggacucugaagcacugcauaaaggggucugucugagcccaauuuacuuccgguggggaagggaaagggaagacaccaccggaagcaaggaaggugcuguguaaucauuaaggagcggaggcuuuuggagcugcuaaaATGCCGGATTACCTCGGTGCCGATC
UTR dot + 25 ………….((……..))…….(((((……)))))……((((((.(..((((((((……………)))))))).).))))))……((((((((((……………….))))))))))…….(((((((.((((((…….(((…(((((…))))))))………))))))..)))))))….
RS 1 seq UUUUGAAAAAAAGCGCCAGGACUAAGUGAAAAAGGAGGUUAAUUAGCUGAAGCUAAUUAACUAAGUUCGACUAACCAAAUCAUAGAUUUGGAGUCUCACUUAUCACUUAAGUUGACGAGGUUGGGGAGUAUCGAAACUUCGGCGGGUGCCCCACGGUAUCGCACUACCGUAAACGACUGGUAAAACUGUAAAGCGAUUUGCAGCACAAAUUCAGUCUGGUGUUAAAA
RS 1 dot ……………….((((((((((……..((((((((((….))))))))))(((((..((((..(((((((…)))))))))))..)))))))))))).)))..(((((((.((…..))..)))))))((.((((((….))))))))..(((((…..((((((…..(((((((….)))))))…….)))))))))))……
RS 2 seq AUUAAAAUAUAAGCGCCAGGAGUUAGGUGAGGUUAAAAUCUUACUUAGAGUAUUUUCAAAAAAGCUAGCAUUUUUGACCUGCUAAUUUUUUAAAUGCCUACUUAACUUGACGAGGAUAGGGAAUAUCGAAAUUUUCGGCGGAUGCCCUACGGUAUAGCACUACCGUUAAAGAUCAAUCAAAACCAAAGAGCGAUUUUUGGGACAAAAUUGAUCGGGUGCUAAUAU
RS 2 dot ………………….(((((((((((….)))))))))))…….(((((((……..))))))).(((((((((((…..(.(((((((………))).)))).)…..))))))…)))))(((((….)))))(((((..((……(((((((…..(((((((….)))))))……))))))))))))))…..
RS 3 seq AAAAAAAAUCGAGCGUGUGGCCCGCUCAGAGAUUUUGCUAAGCAAAAAUCUUGAGCGGGAUACGAGGAAGAGGGGGUCGAUAUCGUAUCGGCCAAUCGGACCGUUUCUUAUUAAAAAUAGGAGCGAGUAUCAGCGGAAACCCUCUGGGUGUGCGAACAUCCAAGAAAAGAUUAAAAUCAAAAACAGCUAGUAAUAACUGACAUUCAAAGUUUUAAUCUACUUCGUUC
RS 3 dot ………….(((((..((((((((.(((((((((…)))))).))))))))))))))))…..(((((((((((((…))))))))..((.((((((((((……….))))))).))…..).))..)))))(((((((….))))))).(((.((((((((((……….((((….))))………))))))))))..)))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table