Detected as a riboswitch by 8 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA085566-1 Similarity: 0.915 Similarity: 0.915 Similarity: 0.914
UTR: 5HSAA085566-1
Gene: PSMC2_2
MFE: -33.164
ENS: 0.822
Length: 227.
Predicted Ligands:
cobalamin - 16/20
glucosamine - 2/20
lysine - 1/20
 RS: URS0000AB56B3_886882
MFE: -65.836
Ligand: glucosamine
Species: Paenibacillus polymyxa SC2 glmS glucosamine-6-phosphate activated ribozyme
 RS: URS000232E134_1794906
MFE: -77.739
Ligand: cobalamin
Species: Marinobacter sp. T13-3 Cobalamin riboswitch
 RS: URS000232FF10_1822219
MFE: -49.273
Ligand: cobalamin
Species: Oleiphilus sp. HI0009 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA085566-1 URS0000AB56B3_886882 URS000232E134_1794906 URS000232FF10_1822219
Length 227. 228. 228. 225.
Similarity - 0.915 0.915 0.914
Ensemble Norm 0.822 - - -
MFE -33.164 -65.836 -77.739 -49.273
Ligands - glucosamine cobalamin cobalamin
Gene PSMC2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 42. 33.004 17.004
Length SE - 1. 1. 4.
Lev Distance - 88. 94. 99.
UBS 13. 18. 17. 16.
BS 0. 0. 0. 0.
ILL 7. 7. 6. 6.
ILR 4. 5. 6. 5.
H 3. 3. 5. 5.
BL 3. 7. 5. 4.
BR 5. 5. 3. 4.
UN 0.079 0.057 0.140 0.142

Sequences

Field Description
UTR seq + 25 aguuuuccuguaaaaaggauuauauuccacgucccagugcaauacauagaacauaaccuuuaaaagcaguucuuuuuauauuaucuuuaaguucuuacugcuuuauguauuaaucugaaccuaaucagugauuuucccaggagcgcuauacuuuuaaguaaaaaaugaaaauaccuguaugaaccaguaucgacgacuaguaATGCCGGATTACCTCGGTGCCGATC
UTR dot + 25 (((.((((((…..((((((((…….((..(((…((((((((……………(((((((……………………..)))))))))))))))…))).))…….))))))))..)))))).))).((((….))))………..((((….(((.((.((((..((…..)).)))).)).)))….))))……
RS 1 seq AACGUAAUACAAGCGCCAGAGCUUGAUUUUGUGCGGGGGAACUUGGUGGAGAAGCAAUAGAUUCCGUUGAGAUGAUAUUGCUCGCAUCGGUUCACGACAAAGCAAGCUGACGAGGUGAAGGUGUUCGAAACAUUCGGCGGGGACCUUCCGGUGAAGCAUCAACCCGUAAACCGGCAGCGGAAAAUGAACAGGCAACUGUUUACACAACGCACCGGUAGAUGCCCAAAU
RS 1 dot ..((.(((((…((((.(((((((.((((((.((…((((.(((((..(.(((((((…((……))…)))))))).))))))))).))))))))))))))..)..))))…)))))))…..((((.((((…..)))).))))(((((………(((((..(((…..(((((((….)))))))…..))).))))).)))))……
RS 2 seq CCUUUGCGCGCGUUUUCAGGUGCCCCGAUGCAAAGCUGCCCGGGGUGAAACGGGAAACUGGUGCGCUCAGAGGCCCCUUUGAGUAAGUCCAGCGCUGCCCCCGCAACGGUAAUUGAGUCAACCGCCAUCGAACGCGCCACUGUGUCCGAGACAUGGGAAGGCGAUGGCCCGGGAUGCCGCCGGCAUCCACUCAUAAGCCCGGAGACCGGCCUGUUAACACACCAAAUG
RS 2 dot ….((.((((((((…((((….(((.(((.((((..(((((.(…(((….(((((..((((((((….))))))))..).))))..)))))))))…))))..))).)))…))))…))))))))))(((((((…)))))))…(((….)))..(((((((…)))))))…….((.((((…)))).))…………….
RS 3 seq ACUAAAUAGAUGCCUUAGGGUAUCUACAGGUUGUGCUAAGAGGAAAUCUGGUGAGAAUCCAGAACUGACGCGCAGCGGUAAUAGGGAACGAAAGCGACACGAUUGGUAUCUCAUAUAGAUUAAGAUCAGGCACUGGAAAGAGCUCCGGGAAGCCGUCGCCGUAGAAAACUAAGCUCAGCUUAUUUGCCCUUAAGUCCGAAGACCUGCCAACGCAGUUCAUCCACA
RS 3 dot ……(((((((……)))))))……(((((…….((((((((((((..((((…((.(((….((………..))…))).))…))))..)))))).))))))…….)))))……(.((..(((….)))..)))(((((….(((((…))))))))))……….((.((.((((….)))).)).))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table