Detected as a riboswitch by 18 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA085571 Similarity: 0.896 Similarity: 0.892 Similarity: 0.889
UTR: 5HSAA085571
Gene: PSMC2_4
MFE: -94.525
ENS: 0.961
Length: 290.
Predicted Ligands:
cobalamin - 16/20
glucosamine - 3/20
FMN - 1/20
 RS: URS000231E0A4_889453
MFE: -62.622
Ligand: cobalamin
Species: Bacteroidales bacterium SC/BZ-SP2 Cobalamin riboswitch
 RS: URS00023131C5_880071
MFE: -54.263
Ligand: cobalamin
Species: Bernardetia litoralis DSM 6794 Cobalamin riboswitch
 RS: URS000231BA34_645127
MFE: -86.918
Ligand: cobalamin
Species: Corynebacterium kroppenstedtii DSM 44385 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA085571 URS000231E0A4_889453 URS00023131C5_880071 URS000231BA34_645127
Length 290. 289. 293. 289.
Similarity - 0.896 0.892 0.889
Ensemble Norm 0.961 - - -
MFE -94.525 -62.622 -54.263 -86.918
Ligands - cobalamin cobalamin cobalamin
Gene PSMC2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 14.002 27.001 74.
Length SE - 1. 9. 1.
Lev Distance - 131. 117. 109.
UBS 13. 15. 16. 19.
BS 0. 0. 0. 1.
ILL 2. 4. 2. 5.
ILR 2. 4. 2. 5.
H 8. 7. 8. 7.
BL 3. 4. 6. 6.
BR 2. 2. 5. 5.
UN 0.131 0.173 0.154 0.111

Sequences

Field Description
UTR seq + 25 augagaaccuuucuggggugcugggggguuccgucccgaaaugcucagcccaauccaugagucagcagcggcgagaggaggaagcaacguuuccuucucacagguaaucaguccaaaaaccagcgugccaaagcguuuccccagggcucuguccggacucugaagcacugcauaaaggggucugucugagcccaauuuacuuccgguggggaagggaaagggaagacaccaccggaagcaaggaaggugcuguguaaucauuaagATGCCGGATTACCTCGGTGCCGATC
UTR dot + 25 ….(((((((((.((….)))))))))))((((…….(((((……….)))))…….)))).((((((((((…..))))))))))…((……..))…….(((((……)))))……((((((.(..((((((((……………)))))))).).))))))……((((((((((……………….))))))))))…….(((((((.((((((…………))))))..)))))))….
RS 1 seq AAUUUUGCAAUUGAAUUUGGUUUUCCGAAUUGCUUUCGCAUUCGGAAUGAAAAGGGAAUCCGGUUAAAAUCCGGAGCUGUACCCGCAGCUGUAAGUUCUGUAAAAAGGUUUUUGAGAUUCUUUGCCACUGGGAAAUCAGUGAUCAGUGUUCAGUUUUCUAUAACAACUGCCAACUGCCAAUUGCUAACUCUUAACUGAUAACUGAUAACUGCUAACUGAACAUUGAAAUACCGGGAAGGCAUCAAAAACAGGAACAAGCCAGAAGACCUGCCAUAAGCAAAUCGAAUGA
RS 1 dot …….(((……)))…(((((((.(((….))))))))))…………((((…….))))((((((….))))))……………..((((((((…….((((.((((….((((((.(((((…(((((.((………………………………………)).)))))…))))).))))))….))))…)))))))))))).((……))….((..(((…..)))..))……
RS 2 seq ACCUUUACAGAUUGAAAAGGUGGUGUUUUUUUAUGAAACUAAAAAAACACUGAAAAGGGAAUACGGUCUUCAUUUUAUGAUUUAUUCCGUAACUGUACCCGCAACUGUGAAUUUGAUUUUUUAGUAAUUAUCUAUUUCUAAAAAAUAGUAUAUACUGCUUCUACACUUAAACUAUAAAGUAUAUACUGCUAAGUAAUUAUUUAAUUUUUGAAAUUUGAUACUUCUGAUUUCUUAUUUCUAAAUUUUUACUUAAUUCAAUCAGUCAGGAGACCUGCCUUUUCAGUUAUUGUACU
RS 2 dot ((((((.((…)).))))))((((((((((((……))))))))))))….(.((((((.((((……….)))))))))).)………(((….)))…….((((((((.(((…..))).))))))))(((((((((((…………………))))))))))).(((((((..(((((……((((((.((….)).))))))…….)))))..)))))))……..((.((((…)))).))…………….
RS 3 seq UUCUUCUGCCCCGCGAAUGGUUUUGCCCCUCUCGUGAAGCAGAAAUACCAGGGAAUCCGGUGCGAAUCCGGAACUGUCCCGCAGCGGUAUGUGAGAAAACCAAACGACACAAUGACGCACUGGUGACCCUCCCCAACCUGGAGAACGCUGGGAAGCAGUGUCAAUUAGGUUCCGCCCCGGAUGGCCACAACCUCACGGCCAUCAGGAACAGCAUCAGGAGCAGCGCACUACAUCGCGCACCAGCGGAGUGCUCACGAGUCCGAAUACCUGCUUAUCGUCGCGGAGCCCG
RS 3 dot …((((((..(((((..((…….))..)))))..))))))……((((.(((((…….)))))….)))).((.((((.(((.(………………).))).)))).))…((((…….)))).((((((…..))))))……((((((((((..(((((((……….))))))).))…((((((.(((…(.(((((…((((……))))))))).)…..)))))…..))))…….))))))))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table