Detected as a riboswitch by 11 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA085572 Similarity: 0.905 Similarity: 0. Similarity: 0.899
UTR: 5HSAA085572
Gene: PSMC2_5
MFE: -85.261
ENS: 0.693
Length: 300.
Predicted Ligands:
cobalamin - 20/20 - 20/20


 RS: URS0002330151_1121476
MFE: -82.873
Ligand: cobalamin
Species: Dethiosulfatibacter aminovorans DSM 17477 Cobalamin riboswitch
 RS: URS000232FFF2_1777139
MFE: -121.229
Ligand: cobalamin
Species: Caballeronia calidae Cobalamin riboswitch
 RS: URS000232E33F_1777132
MFE: -117.733
Ligand: cobalamin
Species: Caballeronia peredens Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA085572 URS0002330151_1121476 URS000232FFF2_1777139 URS000232E33F_1777132
Length 300. 301. 300. 300.
Similarity - 0.905 0.900 0.899
Ensemble Norm 0.693 - - -
MFE -85.261 -82.873 -121.229 -117.733
Ligands - cobalamin cobalamin cobalamin
Gene PSMC2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 28.003 21.003 5.001
Length SE - 1. 0. 0.
Lev Distance - 112. 124. 134.
UBS 19. 22. 21. 20.
BS 0. 0. 0. 0.
ILL 8. 6. 5. 7.
ILR 5. 6. 7. 6.
H 6. 7. 8. 7.
BL 5. 8. 5. 4.
BR 4. 6. 4. 4.
UN 0.060 0.116 0.113 0.093

Sequences

Field Description
UTR seq + 25 aauccaugagucagcagcggcgagaggaggaagcaacgguaaucaguccaaaaaccagcgugccaaagcguuuccccagggcucuguccggacucugaagcacugcauaaaggggucugucugagcccaauuuacuuccgguggggaagggaaagggaagacaccaccggaagcaaggaaggugcuguguaaucauuaaggagcggaggcuuuuggagcugcuaaaaugccggauuaccucggugccgaucagcggaagaccaaagaggaugagaATGCCGGATTACCTCGGTGCCGATC
UTR dot + 25 ..(((.(..(((……)))..).)))((((((…((((….((……))…..))))…..))))))…((((((.(..((((((((……………)))))))).).))))))……((((((((((……………….))))))))))…….(((((((.((((((…….(((…(((((…))))))))………))))))..)))))))((((.((…..(((…((((.(((……….)))))))))))).))))
RS 1 seq AUUAAAUACACUUUUUCAGGUGCCGUUUAUCGGAGAAUAGGGAAUCGGGUGUAAUCCCCGAACGGGCCCGCCACUGUAAUGAACAGUGACUGUCACACGCCACUUCACAUUCCAAUGUAGAGGGAAGGCGGCAGUCACGCAAGAAAGCAACCGCGUUGCGUUAACUGCGUAAGCAGUUAUUAAGCCGCGAAAGAAAGUUUCCUUUAAAGCAUAAUACCAACGAUUCAAGGGAUUAUGAACAGUCUAACUUUCUUGAGCUGAAUGUCUAAGUCAGGAGACCUGCCUGGAGAAUCAGAAUAUU
RS 1 dot ……..(((((….)))))..((((((.(.((….(((..(((((.(….))))))…..)))….)).).)))))).((((((((….((((.((((((((….)))).))))…))))))))))))……..(((((…)))))..(((((((….)))))))……..(..(((((((((……….(((((..((……….))..)))))……..)))))))))..)((((.(.((((.(.((((…))))).)))).).))))……
RS 2 seq ACACUUGCCGCACUUUUUGGUGCUCGCAUUCGCGAAUCUCGCGGAUGCAGUCAAACGGGAAACAGGGAGCGAAGUCUCGAAGUCCGACCGGGACGAGCCAACCUGUGCUGCCCCCGCAACGGUAAGCGACCGCAACGCAAGUUGCAAGUCGUCUCAUGCGCGUUUUUGCAGCGCGAGCGUGUCGAAUUUCAUCGCACGGACUCGACUGCAAGAAACGUGUCGACGCCACUGCGCACGAUGCGCGGGAAGGCGAGACGAUCCGUCGCCAGCCCGGAUACCGGCCAAAGCUCGACGCAUCGG
RS 2 dot ………(((((….)))))..((((((((((…))))))))))……..(((..(((((..((…((((((………))))))..))…)))))….)))(((…)))…(((((.(((((….)))))..)))))…..((((((((((((((((.(..((((.(((……)))))))..).)).))))))))).)))))…((((.(((((((…)))))))…))))…((((.(((((..(((((((…))))…..)))))))).)))).
RS 3 seq UACACUUGCCGCACUUUUGGUGCUCGCAUUCGCGGAUCUCGCGAAUGCAGUCAAACGGGAAACAGGGAGCGAAGUCCUCGAAGCACACCGGGACGAGCCAACCUGUGCUGCCCCCGCAACGGUAAGCGACCGCAACGCAAGUUGCAAGUCGUCCCUUGCGCGUUUCUGCAUGACAGGCGCGUGUUUUCUCAUCACGCGAAACCACUGCAAGAAACGUGUCGAUGCCACUGCGCACGUUUGCGCGGGAAGGCGGGGCGAUGUGUCGCCAGCCCGGAUACCGGCCGGAGUUCGACGCGCACG
RS 3 dot ……….(((((…)))))..(((((((((…..)))))))))……..(((..(((((..((…((((.((……..))))))..))…)))))….))).(((((.((…(((((.(((((….)))))..))))).)))))))((((((((((…….((((((………))))))…….)))).))))))((((..((((.(((((((….)))))))…)))).))))..((((((..(((((((…….)))).)))))))))…..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table