Detected as a riboswitch by 2 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA085576 Similarity: 0.987 Similarity: 0.987 Similarity: 0.987
UTR: 5HSAA085576
Gene: PSMC3IP
MFE: -13.567
ENS: 0.810
Length: 68.
Predicted Ligands:
homocysteine - 10/20
fluoride - 7/20
glutamine - 2/20
 RS: URS0000ABA3A8_655186
MFE: -16.092
Ligand: homocysteine
Species: uncultured SUP05 cluster bacterium S-adenosyl-L-homocysteine riboswitch
 RS: URS0000BE7C7C_65093
MFE: -17.001
Ligand: glutamine
Species: Halothece sp. PCC 7418 Glutamine riboswitch
 RS: URS0000D8E98B_1805050
MFE: -17.396
Ligand: homocysteine
Species: Betaproteobacteria bacterium CG2_30_59_46 S-adenosyl-L-homocysteine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA085576 URS0000ABA3A8_655186 URS0000BE7C7C_65093 URS0000D8E98B_1805050
Length 68. 67. 68. 68.
Similarity - 0.987 0.987 0.987
Ensemble Norm 0.810 - - -
MFE -13.567 -16.092 -17.001 -17.396
Ligands - homocysteine glutamine homocysteine
Gene PSMC3IP - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3. 4.011 6.003
Length SE - 1. 0. 0.
Lev Distance - 15. 16. 16.
UBS 4. 4. 4. 4.
BS 0. 0. 0. 0.
ILL 1. 2. 1. 1.
ILR 0. 0. 1. 1.
H 1. 1. 2. 1.
BL 2. 1. 1. 1.
BR 2. 1. 1. 0.
UN 0.412 0.403 0.309 0.353

Sequences

Field Description
UTR seq + 25 aacuacaacguccggcuuucugaguuggguggcgggaaaggcgATGTACGGCAAGCAGAAGATCTATT
UTR dot + 25 …….((((.((.((((((..(((….))).)))))).))))))…………………
RS 1 seq CUCGCCGAGGAGCGUUGCAUUGGGAAUCCCCAUCAGGCUCGGCAAUCAAAAACGACGCUCAUUUAUU
RS 1 dot …(((…((((.(((…((((….)))).))))))))))……………………
RS 2 seq AUCGUUCAUCUCUCUAACGGAAAUCUUCUAGAGAGACGGAAGUAGGGAACUCCCCGAAGGAACGCGCC
RS 2 dot ….(((.((((((((..((….))..)))))))).)))….(((…..)))………….
RS 3 seq CCAACCGAGGAGCGCUGCAACGGAUUCCUUCCGUCAGGCUCGGCUUUCGAAAACUGCGCUUACCUGUA
RS 3 dot …..((((((((.(((..(((((…..))))))))))))….))))……………….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table