Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA085577 Similarity: 0.952 Similarity: 0.951 Similarity: 0.949
UTR: 5HSAA085577
Gene: PSMC3IP_0
MFE: -63.545
ENS: 0.816
Length: 170.
Predicted Ligands:
cobalamin - 7/20
FMN - 5/20
lysine - 4/20
 RS: URS0000C7D174_1262780
MFE: -35.704
Ligand: lysine
Species: Clostridium sp. CAG:221 Lysine riboswitch
 RS: URS0000ABAAA4_349519
MFE: -44.735
Ligand: lysine
Species: Leuconostoc citreum KM20 Lysine riboswitch
 RS: URS0000C8A42C_748449
MFE: -33.397
Ligand: lysine
Species: Halobacteroides halobius DSM 5150 Lysine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA085577 URS0000C7D174_1262780 URS0000ABAAA4_349519 URS0000C8A42C_748449
Length 170. 170. 169. 171.
Similarity - 0.952 0.951 0.949
Ensemble Norm 0.816 - - -
MFE -63.545 -35.704 -44.735 -33.397
Ligands - lysine lysine lysine
Gene PSMC3IP - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 13.007 10.001 3.001
Length SE - 0. 1. 1.
Lev Distance - 57. 58. 65.
UBS 13. 13. 13. 12.
BS 0. 0. 0. 0.
ILL 3. 3. 4. 3.
ILR 6. 3. 4. 5.
H 2. 2. 2. 2.
BL 5. 5. 4. 4.
BR 5. 7. 7. 5.
UN 0.053 0.135 0.089 0.082

Sequences

Field Description
UTR seq + 25 ggaguccgggaggggucgcuuugcuccuccggaaggcuuccccuucagccaaucaccguucgaggcccgcccccgucgccggaaggagccgucgccccgagcaacuacaacguccggcuuucugaguuggguggcgggaaaggcgATGTACGGCAAGCAGAAGATCTATT
UTR dot + 25 (((((((.((((((((……)))))))).)..))))))..((((.((……((((.((..(((….(((((((((.((((((((((.((…………….))..)))))).))…)).)))))))))…)))..)).))))…)).))))…….
RS 1 seq UUGCAAGAUAGAGGUGCGAUACUUAUCAGUACUAUUAAGGAGCUAAGCACAAUGAUUUAAUAGGAAAGGAUUUAUCGCCGAAGUAAAUAGCCUAUGCUUUACAGCUAUUUACUGGGGAUCCAUAUAAUAUAUGUAUUCCUGUCACAUUUUUGUGGAGAGCUAUCAUUUAA
RS 1 dot …………((((((((….))).)))))…..((((((…(((((.(((…(((((((.(.((.((((.((..((((((((((…………)))))))))))).))………)).)).).)))))))…))).)))))…)))).))……
RS 2 seq AGUUAUCAAAGAGGUUGCAACCAACAUGAUUAGCGCAAAUGAGUUCGCCAAGAACUGUGACUUUGCGUCAAAGGGGCGGUUGCCGAAAUAUCAUUUAAGGCAGAAUGAUAUUGGGCUAACAACUAAUACUUGUUAGACUGUCACAGUGAUGUGGUGUGCUUUGAAAAGU
RS 2 dot .(((((((….(((….)))….)))).)))……((((.((((((..((((((((…..(((.((.(((.(((((((..((((((((((……)))))))))).)))….))))….))).)).))).))))))))..).))))).))))……..
RS 3 seq UAGAAUGAUAGAGGAGCAAUGAUUAUUAGUACUUCUAAGGAGCUAGGUCUGAGUGUAGAAUUAGGAGGAAAGGGAUUAUUGCCGAAGCCCUAAAAGCAAUUGCUAUCUCUUAGGGUUGGGGAUAUAAUUAAUAGUUAUAUUACUGCCACUUUGUGGAGAGCUAUCUUACGA
RS 3 dot ……..((((((.(((((….))).)).))))))..(((.(((.(((((((((((……………((((((..((..((((((((.(((….)))…..))))))))..))..))))))………….)))).))))…..))).))).)))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table