Detected as a riboswitch by 2 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA085627 Similarity: 0.971 Similarity: 0.971 Similarity: 0.968
UTR: 5HSAA085627
Gene: PSMD10
MFE: -40.075
ENS: 0.826
Length: 123.
Predicted Ligands:
TPP - 7/20
glycine - 6/20
homocysteine - 2/20
 RS: URS0000C0AFEF_891968
MFE: -42.927
Ligand: molybdenum
Species: Acetomicrobium mobile DSM 13181 Moco (molybdenum cofactor) riboswitch
 RS: URS0000AB421D_331117
MFE: -26.942
Ligand: TPP
Species: Neosartorya fischeri NRRL 181 TPP riboswitch (THI element)
 RS: URS0000C55045_1439940
MFE: -52.991
Ligand: homocysteine
Species: Pseudomonas sp. BAY1663 S-adenosyl-L-homocysteine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA085627 URS0000C0AFEF_891968 URS0000AB421D_331117 URS0000C55045_1439940
Length 123. 124. 123. 123.
Similarity - 0.971 0.971 0.968
Ensemble Norm 0.826 - - -
MFE -40.075 -42.927 -26.942 -52.991
Ligands - molybdenum TPP homocysteine
Gene PSMD10 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3. 6. 23.004
Length SE - 1. 0. 0.
Lev Distance - 36. 37. 32.
UBS 10. 11. 11. 9.
BS 0. 0. 0. 0.
ILL 2. 2. 2. 3.
ILR 0. 0. 2. 2.
H 3. 3. 3. 3.
BL 4. 5. 4. 3.
BR 4. 5. 5. 0.
UN 0.138 0.121 0.138 0.073

Sequences

Field Description
UTR seq + 25 auuggugaagcucuaacggcuguuuugacuggcguagccggagccggcgacgugaggcgggcguugcucgcgcgacaaguaguugcugggacagcgaaATGGAGGGGTGTGTGTCTAACCTAA
UTR dot + 25 .((((((.(((…((((.((((…..((.((((.((((….)))).)))).)))))).)))))))))).)))…….((((((…))))))…….((((………))))..
RS 1 seq GUGUGCCGUGUUUUCCGAGUUGUCAGCCUUCCUCGCAAGCCAGGGAGAUGGCUGCCAGCCGAUAGGGCAUAGCGGGAAACGGUUAUGCCUCCCACCUUUGGAAAGGAAAACAACUUGUUGUCCC
RS 1 dot .((((((.(((….((.((((.(((((.(((((……..))).)).))))).))))))))).))))))..((((…(((…)))))))………..(((.((((…)))).))).
RS 2 seq GUAACUCUUGACUGGAGUGCAUCCGAGAGAGCCACGGUGCCAAUGGAUGGGUUCGUUCUGAGAUUAUACGGUCAAAACUUGAUCUGGAUAAUACCAGCGAAAGGAUCAUGCCUUCCCUCUGUU
RS 2 dot …….(((((((..(((.(((((((.(((((.(.((….)).)…))))).))).).)))))).)))))))……..((((……))))((…(((……..)))…))..
RS 3 seq CCGUCCGAGGGGCGCUGCAGCAGAUGGAGAACCGUUUCGAACCUGGCGAAGGUCGAAUCCGGUUCUCGCCUGUCAGGCUCGGAUGGGGCGUUUCCUCGAACGCAUCAACGGCGCCCAUUCGCA
RS 3 dot ((((((((…((.(((..((((…((((((((.((((.((((…..))))))))..))))))))..))))))))))))))))).((((((….))))))…….(((……))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table