Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA085629 Similarity: 0.969 Similarity: 0.968 Similarity: 0.966
UTR: 5HSAA085629
Gene: PSMD10_0
MFE: -45.049
ENS: 0.968
Length: 149.
Predicted Ligands:
cobalamin - 9/20
molybdenum - 5/20
FMN - 5/20
 RS: URS0002312FE1_1916956
MFE: -49.612
Ligand: cobalamin
Species: Synechococcus sp. SynAce01 Cobalamin riboswitch
 RS: URS0000ABA5F4_668336
MFE: -29.369
Ligand: molybdenum
Species: Aggregatibacter actinomycetemcomitans D11S-1 Moco (molybdenum cofactor) riboswitch
 RS: URS0000095309_376219
MFE: -44.775
Ligand: cobalamin
Species: Arthrospira sp. PCC 8005 Cobalamin
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA085629 URS0002312FE1_1916956 URS0000ABA5F4_668336 URS0000095309_376219
Length 149. 149. 149. 147.
Similarity - 0.969 0.968 0.966
Ensemble Norm 0.968 - - -
MFE -45.049 -49.612 -29.369 -44.775
Ligands - cobalamin molybdenum cobalamin
Gene PSMD10 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4.001 11. 4.
Length SE - 0. 0. 4.
Lev Distance - 40. 38. 38.
UBS 10. 9. 9. 9.
BS 0. 0. 0. 0.
ILL 2. 1. 3. 1.
ILR 0. 1. 2. 0.
H 4. 4. 4. 5.
BL 3. 2. 1. 2.
BR 4. 4. 3. 4.
UN 0.181 0.215 0.168 0.184

Sequences

Field Description
UTR seq + 25 agaaaagggaacgaggaaggccggugauuggugaagcucuaacggcuguuuugacuggcguagccggagccggcgacgugaggcgggcguugcucgcgcgacaaguaguugcugggacagcgaaATGGAGGGGTGTGTGTCTAACCTAA
UTR dot + 25 ………..(((((..(((((….((((…….))))))))).))))).((.((((.((((….)))).)))).))…..(((((((((.(((((…..))))))))).)))))……..((((………))))..
RS 1 seq CAUAAUCAGAUUCGAAACGGUUUCAGCGGGGAACAGCCGCUGAAGGCAACAGGGAAAGUGCCGUUCGAAUCGGCCGCUGUCCCGCAACUGUGAUUUGGCUUGUUUUCAAGUCGAUAAGUCAGGAUUCCUGCCGUUUUGCACAAUCCAAC
RS 1 dot ………………(.(((((((((…….))))))))).)….((((.(((((((…….)))).))).))))…….((((((((((((….))))))))…))))(((((..(((……))).)))))…
RS 2 seq UAACGCAUAUAACUCCGAGUUUACUUAACCUACGUUUUGGUCUCAAAAUAGGGUGGUAAUGCCAAUAAUACGCAGUUCGUAUUAUUCAGGGAUACGUUGGAAACGAUUUAUCCUCUCCGUUUUUAGAAAGGUGUCAAAUGCAAACCAUU
RS 2 dot ….((((…(((((..((((…..(((……..)))….))))..)).))).)))).(((((((((…..)))))))))..((((((.((((….)))).))))))……………(((………..)))…
RS 3 seq UAAGAUAUUCCCGAUAUCGGUUCUAAGGGAAAUCAGCCCUUAGAGGAAAGGGGGAAAGUCCGGUGUAAGUCCGGCGCUGUCCCGCGACUGUGAUGGGACUCUGUUAGUCUCUCAGUCAGAAUGCCCGCCGAUAAGUAACCUAUUGUU
RS 3 dot ……….(((….)))(((((((((…….)))))))))….(.((((.(((((((…….)))).))).)))).)(((((….((((((…..)))))).)))))………..(((((…….)))))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table