Detected as a riboswitch by 16 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA085660 Similarity: 0.980 Similarity: 0.979 Similarity: 0.978
UTR: 5HSAA085660
Gene: PSMD4
MFE: -31.021
ENS: 0.912
Length: 108.
Predicted Ligands:
SAM - 19/20
methionine - 1/20

 RS: URS0000D7829B_1090615
MFE: -39.861
Ligand: methionine
Species: Nakamurella sp. P4-7 S-adenosyl methionine (SAM) riboswitch,
 RS: URS0000ABB181_431943
MFE: -23.454
Ligand: SAM
Species: Clostridium kluyveri DSM 555 SAM riboswitch (S box leader)
 RS: URS0000D94201_1798005
MFE: -30.965
Ligand: SAM
Species: Candidatus Falkowbacteria bacterium RIFOXYC2_FULL_48_21 SAM riboswitch (S box leader)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA085660 URS0000D7829B_1090615 URS0000ABB181_431943 URS0000D94201_1798005
Length 108. 107. 108. 109.
Similarity - 0.980 0.979 0.978
Ensemble Norm 0.912 - - -
MFE -31.021 -39.861 -23.454 -30.965
Ligands - methionine SAM SAM
Gene PSMD4 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 5.002 3.001 2.007
Length SE - 1. 0. 1.
Lev Distance - 24. 27. 28.
UBS 6. 7. 7. 7.
BS 0. 0. 0. 0.
ILL 1. 0. 1. 0.
ILR 2. 1. 3. 2.
H 3. 3. 3. 3.
BL 2. 3. 2. 2.
BR 1. 2. 0. 1.
UN 0.204 0.159 0.176 0.284

Sequences

Field Description
UTR seq + 25 auuggugaagagcgacgggccaauuggaggaguuguuguuaggccgucccggagacccggucgggagggaggaagguggcaagATGGTGTTGGAAAGCACTATGGTGT
UTR dot + 25 ……….((((((((.((…….))..))))))))…((.((((((……..)))))).))………(((..((((((((….))))))))..)))
RS 1 seq GCUCAAGAGUGUCAGCGUCAAGAUCCGGCUCGCUGACCGGCAACCCUUCUCCGCGAUGGGGUGCCCCGGAGAUAGAGCCGGCCGGCUUGUCCGGCAAUUCGCGGCUC
RS 1 dot ……..(.(((((((………….))))))))((((.(((.((…..)).))).))))………(((((((((((…..)))))……))))))
RS 2 seq UCCUUAUCAAGAGAAACUUAGGGAAUGGCCCGAUGAAGUUUCAGCAACCACAUUUUAAUUUUAUGUAAGGUGCUAAGUCCAUCAGAACAUAGUUCUGGAAGAUGAGGU
RS 2 dot …………(((((((.(((…..)))….)))))))(((.(((((((………))))..))))))..(((..(((((((…)))))))..)))…..
RS 3 seq UAAAUAUCAAGAGUGAGGUUAGGGCUCUGGCCCAAUGAUCCUCCGGCAACCUAGCAAACGCAAAGGUGCCAACUCCAGCUCUUCAUUAAUAACAUGAAGGGGCAGAUAA
RS 3 dot …………..(((((((((((….))))..))).)))).(((.((((.((….))..)))))))……..((((((((…….))))))))……..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table