Detected as a riboswitch by 2 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA085667 Similarity: 0.985 Similarity: 0.985 Similarity: 0.985
UTR: 5HSAA085667
Gene: PSMD6_0
MFE: -12.737
ENS: 0.785
Length: 64.
Predicted Ligands:
fluoride - 14/20
homocysteine - 5/20
cobalamin - 1/20
 RS: URS0000BFEBDC_309799
MFE: -15.727
Ligand: fluoride
Species: Dictyoglomus thermophilum H-6-12 Fluoride riboswitch
 RS: URS0000BF90D1_323259
MFE: -17.140
Ligand: fluoride
Species: Methanospirillum hungatei JF-1 Fluoride riboswitch
 RS: URS0000DA6BFE_1873176
MFE: -20.381
Ligand: fluoride
Species: Pseudaminobacter manganicus Fluoride riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA085667 URS0000BFEBDC_309799 URS0000BF90D1_323259 URS0000DA6BFE_1873176
Length 64. 64. 63. 63.
Similarity - 0.985 0.985 0.985
Ensemble Norm 0.785 - - -
MFE -12.737 -15.727 -17.140 -20.381
Ligands - fluoride fluoride fluoride
Gene PSMD6 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6.002 4. 4.002
Length SE - 0. 1. 1.
Lev Distance - 18. 18. 18.
UBS 6. 7. 5. 6.
BS 0. 0. 0. 0.
ILL 1. 1. 0. 0.
ILR 2. 2. 1. 1.
H 1. 1. 1. 1.
BL 3. 5. 3. 4.
BR 3. 2. 2. 4.
UN 0.094 0.047 0.111 0.048

Sequences

Field Description
UTR seq + 25 ccaaguuguguccugucagccgcuguccccuucgccgcgATGAATGAGAGTAACGACTCGACAA
UTR dot + 25 ….((((.(((((.(((..(((.((…….)).)))…..))).))….))).))))..
RS 1 seq AUCACAAGUGGCGAUGGAGUCCGCCAUAUAAUUGCCGAUAAAGGCUGAUGACUCCUACUUAUGU
RS 1 dot ..((.((((((.((.(..(((.(((.(((……..)))..))).)))..))))))))).)).
RS 2 seq GUAAACCAGGGUGAUGGGGUUCACCUGUAACCGCUUUUUCCAGCUGAUGACUCCUCUUCCUGU
RS 2 dot ……(((((.((.((((((((.(((………….))).)))..))))))).))))).
RS 3 seq GGCUUCGAUGGGAAUGGAGUUCUCCCGAAAGCGCCUGUGAGAGCUGAUGACUCCUAUCGCGGA
RS 3 dot ..((.((((((((.(.((((((((.((……..)).)))))))..).).)))))))).)).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table