Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA085677 Similarity: 0.989 Similarity: 0.983 Similarity: 0.982
UTR: 5HSAA085677
Gene: PSMD6_1
MFE: -16.518
ENS: 0.991
Length: 78.
Predicted Ligands:
cobalamin - 6/20
SAM - 6/20
zmp-ztp - 5/20
 RS: URS0000C5F63A_1302244
MFE: -23.075
Ligand: cobalamin
Species: Propionibacterium acnes JCM 18920 Cobalamin riboswitch
 RS: URS000231D29F_1032480
MFE: -30.856
Ligand: zmp-ztp
Species: Microlunatus phosphovorus NM-1 ZMP/ZTP riboswitch
 RS: URS0000C541B1_47853
MFE: -33.517
Ligand: homocysteine
Species: Micromonospora carbonacea S-adenosyl-L-homocysteine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA085677 URS0000C5F63A_1302244 URS000231D29F_1032480 URS0000C541B1_47853
Length 78. 77. 77. 78.
Similarity - 0.989 0.983 0.982
Ensemble Norm 0.991 - - -
MFE -16.518 -23.075 -30.856 -33.517
Ligands - cobalamin zmp-ztp homocysteine
Gene PSMD6 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3. 6. 6.001
Length SE - 1. 1. 0.
Lev Distance - 12. 20. 22.
UBS 8. 8. 8. 8.
BS 0. 0. 0. 0.
ILL 3. 4. 3. 2.
ILR 3. 2. 1. 3.
H 2. 2. 2. 2.
BL 3. 2. 2. 1.
BR 2. 2. 3. 3.
UN 0.026 0.013 0.013 0.051

Sequences

Field Description
UTR seq + 25 gcagccggucguaaccaaguuguguccugucagccgcuguccccuucgccgcgATGAATGAGAGTAACGACTCGACAA
UTR dot + 25 .((((.(((….)))..))))((((..(((.(..(((.((…((((……)))).)).)))..))))..)))).
RS 1 seq GGGAAGUCGGUGAGUAUUCCGGCGCUGUCCCGCAACCGUGACCUGGAUGUGUUAAUUCAUCUGGAAGCCGGAACGCC
RS 1 dot .((((..(…..)..))))((((…(((.((..(((.((..(((((……))))))))))..)).))).))))
RS 2 seq UCGCAUCCACACGACUGGCGCGGGUGGGCGGACCACCGGGGAGUGACGUCAGGGCAUCGACCGCCUGGGUGCCCGCC
RS 2 dot .(((..(((……))).)))((((((((…(.(((((..((((.((….)).)).))..))))))))))))))
RS 3 seq CAGGCCGAGAGGCGCUGCGACGGGCCCGGCCCGCCACGCUCGACCUGGGAGCAUGUGGACCAAGGGCGCCUCCGAGAC
RS 3 dot ((((((….))).)))((..((((((((.((((…((((…….))))..)))).))..)))).))..))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table