Detected as a riboswitch by 14 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA085684 Similarity: 0.988 Similarity: 0.987 Similarity: 0.987
UTR: 5HSAA085684
Gene: PSMD6_2
MFE: -12.501
ENS: 0.884
Length: 58.
Predicted Ligands:
unknown - 15/20
fluoride - 2/20
glutamine - 2/20
RS: URS0000E60980_92647
MFE: -18.570
Ligand: unknown
Species: Burkholderia tropica nhaA-I RNA
RS: URS0000D6828C_12908
MFE: -16.970
Ligand: unknown
Species: unclassified sequences nhaA-I RNA
RS: URS0000E60013_505353
MFE: -25.887
Ligand: unknown
Species: Roseovarius halotolerans sul1 RNA
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA085684 URS0000E60980_92647 URS0000D6828C_12908 URS0000E60013_505353
Length 58. 57. 56. 58.
Similarity - 0.988 0.987 0.987
Ensemble Norm 0.884 - - -
MFE -12.501 -18.570 -16.970 -25.887
Ligands - unknown unknown unknown
Gene PSMD6 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2. 5. 2.
Length SE - 1. 4. 0.
Lev Distance - 14. 11. 17.
UBS 6. 6. 5. 6.
BS 0. 0. 0. 0.
ILL 3. 2. 1. 2.
ILR 2. 1. 2. 2.
H 1. 1. 1. 1.
BL 2. 2. 2. 2.
BR 2. 2. 2. 1.
UN 0.052 0.053 0.054 0.069

Sequences

Field Description
UTR seq + 25 uguguccugucagccgcuguccccuucgccgcgATGAATGAGAGTAACGACTCGACAA
UTR dot + 25 ..((((..(((.(..(((.((…((((……)))).)).)))..))))..)))).
RS 1 seq GGGUGUUAGCUGCAUACCGCAGCGGGACAGGCUUUUCGCGCUGGUCGGGCCGCCACG
RS 1 dot ..(((…((.((…((((((((.((……..)).)))))..))))).))))).
RS 2 seq GGGUGUUGGCUGCAUACCGCAGUGGAACAGGUUCAUGCGCAGGUCGGGCCGCCGCG
RS 2 dot ..(((.(((((….(((((.(((((…..)))))..)).)))..))))).))).
RS 3 seq CAAGGAGCCGGGUGCGAUCCCCGGCUGGCUCUUCCGGCCGCCGAUCCGCCGGACAACA
RS 3 dot …(..(((.((((.((((..(((((((…..)))))))..)))))))))).)..).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table