Detected as a riboswitch by 4 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA085687 Similarity: 0.964 Similarity: 0.961 Similarity: 0.961
UTR: 5HSAA085687
Gene: PSMD7
MFE: -64.679
ENS: 0.768
Length: 157.
Predicted Ligands:
SAM - 10/20
TPP - 6/20
glucosamine - 2/20
 RS: URS0000AB4074_759273
MFE: -54.170
Ligand: TPP
Species: Colletotrichum higginsianum IMI 349063 TPP riboswitch (THI element)
 RS: URS0000AB6289_983644
MFE: -59.504
Ligand: TPP
Species: Cordyceps militaris CM01 TPP riboswitch (THI element)
 RS: URS0000C48578_1237896
MFE: -66.170
Ligand: TPP
Species: Colletotrichum gloeosporioides Cg-14 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA085687 URS0000AB4074_759273 URS0000AB6289_983644 URS0000C48578_1237896
Length 157. 156. 156. 158.
Similarity - 0.964 0.961 0.961
Ensemble Norm 0.768 - - -
MFE -64.679 -54.170 -59.504 -66.170
Ligands - TPP TPP TPP
Gene PSMD7 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7. 4.005 21.
Length SE - 1. 1. 1.
Lev Distance - 43. 49. 40.
UBS 11. 11. 11. 12.
BS 0. 0. 0. 0.
ILL 2. 3. 1. 2.
ILR 4. 5. 3. 4.
H 2. 2. 3. 2.
BL 6. 4. 6. 2.
BR 4. 3. 3. 6.
UN 0.159 0.141 0.090 0.139

Sequences

Field Description
UTR seq + 25 aagaaggaggccgcgcgagggcugacgaaccggaagaagaggaacugggccugaaaggguaccggugaccgcuacugcugccgguguuugcguguggcagggagccaggccuggcgagcggggugugucgcgATGCCGGAGCTGGCAGTGCAGAAGG
UTR dot + 25 ………((((((((.((((……(((((.((.((.((.(((((((((….)))).)))))..)).)).))….))))))))).))))))))…..(((((..((((((.((((……))))..))))))..)))))………..
RS 1 seq AAAUGCAUGAGCCGGUGCCCACCUGAGGCCUGUCGUCCGCUGCCACCUCUCCAUCUCCAUGGUGACCCAGCGGUCGACGCCGAUGGUGGGCUGAGAUUAUACGGCCUUGAACUUGAUCUGGGUAAUACCAGCGAAAGGAUCAUGCAACCUAACAUA
RS 1 dot ……….(((((((((((((…(((..((((.((((((.((((………….))))…)))))).)))))))…)))))))…….)).))))(.(((.(((…((((……))))…)))..))).)…………
RS 2 seq UGGAAUGCAACCGGGUGUUCAAUGUGUCGCCCGGCGCGGCAGCUUCGGCACUCUGACAGGUGUCAAGCUGCGGUACCGUGUGACGCAUUGAUCUGAGAAAUACCGGCGAACUUGAUCUGGAUAAUACCAGCGAAAGGAUCUGCAUCUGAUAUGCCC
RS 2 dot ……….(((.((((((((((((((((.(((.((.(((((((.((((((……))))))))))))).)).))).))))))))))))……..))))))).((.(((…((((……))))…)))..)).((((…..))))..
RS 3 seq AAACGCAUGAGCCGGUGCCCAGUCUCUCACCCUGCCUACGUCGCUGCCAUCUCAUGGUGCCGCCAGCGACCGGCGCGGGUGAAGGGGCUGGGCUGAGAACACACGGCCUUGAACUUGAUCUGGGUAAUACCAGCGAAAGGAUCAUGCACCCUAACACA
RS 3 dot ……….((((((((((((((((((((((((((…((((((((((((….))))..)).)))))).)))).)))))).))))))))))…….)).))))(.(((.(((…((((……))))…)))..))).)…………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table