Detected as a riboswitch by 14 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA085692 Similarity: 0.983 Similarity: 0.981 Similarity: 0.978
UTR: 5HSAA085692
Gene: PSMD8
MFE: -28.996
ENS: 0.
Length: 91.
Predicted Ligands:
zmp-ztp - 7/20
TPP - 6/20
glycine - 3/20
 RS: URS00001874E4_661367
MFE: -18.833
Ligand: TPP
Species: Legionella longbeachae NSW150 TPP
 RS: URS0000DAB6B8_1834178
MFE: -18.488
Ligand: TPP
Species: Enterococcus sp. 3H8_DIV0648 TPP riboswitch (THI element)
 RS: URS0000D93B10_66430
MFE: -36.470
Ligand: zmp-ztp
Species: Streptomyces roseus ZMP/ZTP riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA085692 URS00001874E4_661367 URS0000DAB6B8_1834178 URS0000D93B10_66430
Length 91. 92. 92. 91.
Similarity - 0.983 0.981 0.978
Ensemble Norm 0. - - -
MFE -28.996 -18.833 -18.488 -36.470
Ligands - TPP TPP zmp-ztp
Gene PSMD8 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4.012 7.017 5.002
Length SE - 1. 1. 0.
Lev Distance - 21. 22. 28.
UBS 6. 7. 5. 7.
BS 0. 0. 0. 0.
ILL 2. 3. 1. 3.
ILR 1. 1. 1. 1.
H 3. 2. 2. 2.
BL 0. 0. 2. 1.
BR 1. 2. 1. 2.
UN 0.099 0.207 0.228 0.055

Sequences

Field Description
UTR seq + 25 aguuagggcaaaagccaacuuccggucaccaucuugagugacgacagaggcggagcuccaacugacATGTTCATTAAGGGCAGGGCTCCGA
UTR dot + 25 ……(((….)))..((((..(((((((…)).)))))….))))((((((((………(((((…..))))))))))))).
RS 1 seq AUUGUACAUUAGGGGUGCCUGUUUCACUAUUUUGGCUGAGAGGAUCCACCAACCCUUUGAACCUGAUCUCAUUAGUCUGAGCGGAGGAAAAU
RS 1 dot ………..((((..(((..(((((((…))).)))))))..)).))…((((((……..((((……))))))))))…..
RS 2 seq GAAUGACACUAGGGGUGCUUUUAGAGCUGAGAUUAUACCCAUUGAACCUGAAACAGUUAGAACUGACGCAGGGAAUGUGUGAUGUUUUAGAA
RS 2 dot …………(((((.(((((….)))))…)))))…….((((((((……..(.(((((…..))))).)))))))))..
RS 3 seq GCUACGCACGGCGACUGGCGUACGGAGAACCAACUCCGGGGGAGUCGUGCGCGCAGGACCGCAUACAGGGCCGCUCGCCUGGGCCUCGCGG
RS 3 dot ….((((((((..((……(((((……))))).))..))))))))((((((.((…..((((……..))))))))).))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table