Detected as a riboswitch by 19 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA085707 Similarity: 0.980 Similarity: 0.979 Similarity: 0.979
UTR: 5HSAA085707
Gene: PSMD9
MFE: -40.637
ENS: 0.930
Length: 96.
Predicted Ligands:
glycine - 6/20
TPP - 4/20
purine - 2/20
 RS: URS0000C896CD_1736322
MFE: -32.
Ligand: TPP
Species: Nocardioides sp. Leaf285 TPP riboswitch (THI element)
 RS: URS0000ABC19F_203123
MFE: -20.250
Ligand: purine
Species: Oenococcus oeni PSU-1 Purine riboswitch
 RS: URS0000ECDC54_1247
MFE: -19.550
Ligand: purine
Species: Oenococcus oeni Purine
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA085707 URS0000C896CD_1736322 URS0000ABC19F_203123 URS0000ECDC54_1247
Length 96. 96. 95. 95.
Similarity - 0.980 0.979 0.979
Ensemble Norm 0.930 - - -
MFE -40.637 -32. -20.250 -19.550
Ligands - TPP purine purine
Gene PSMD9 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.002 11. 11.
Length SE - 0. 1. 1.
Lev Distance - 25. 21. 21.
UBS 11. 11. 10. 10.
BS 0. 0. 0. 0.
ILL 2. 1. 3. 3.
ILR 2. 3. 1. 1.
H 1. 1. 1. 1.
BL 7. 7. 5. 5.
BR 7. 6. 5. 5.
UN 0.042 0. 0.063 0.063

Sequences

Field Description
UTR seq + 25 aguuacggucgacuggggcgucgucccuagcccgggagccgggucucuggagucgcggcccgggguucacgATGTCCGACGAGGAAGCGAGGCAGA
UTR dot + 25 .(((.((.((..((.(((((((((….(((((.((.((((.(.((….)).).)))))).))))).))))))))).).)..))..)).)))…
RS 1 seq GCGGACGACACGGGGUGCCCGCCGACGCGGGCUGAGAGCAGACCCGUCGAACCUGAUCUAGCUCGCACUAGCGAAGGGAUGUCGCCGUGGACCAGC
RS 1 dot ((((.(.((.(((.((.(((((….(((((((.(((.(((………..))).))))))))))….)))..)).)).)))..)).).)).))
RS 2 seq AAGAUAAAUAGCAACCAAGCAGGUAUAUCGUCGGAUAAUGGCUGACAGUUUCUACCCAACACCAAUGUUGGACUAUCUGUGGAUGUCUUUUUGGC
RS 2 dot ….((((.((((.((..(((((((….(((.((((.(((.((…((….))….))))).)))).)))))))))))).)).)).))))..
RS 3 seq AAGAUAAAUAGCAACCAAGCGGGUAUAUCGUCGGAUAAUGGCUGACAGUUUCUACCCAACACCAAUGUUGGACUAUCUGUGGAUGUCUUUUUGGC
RS 3 dot ….((((.((((.((..(((((((….(((.((((.(((.((…((….))….))))).)))).)))))))))))).)).)).))))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table