Detected as a riboswitch by 12 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA085857 Similarity: 0.989 Similarity: 0.989 Similarity: 0.988
UTR: 5HSAA085857
Gene: PTAR1
MFE: -15.702
ENS: 0.875
Length: 47.
Predicted Ligands:
SAM - 10/20
preQ_1 - 9/20
glutamine - 1/20
 RS: URS0000B74E45_1673631
MFE: -16.067
Ligand: SAM
Species: Maliponia aquimaris SAM/SAH riboswitch
 RS: URS0000B7EAE9_1529041
MFE: -16.138
Ligand: SAM
Species: Roseivivax jejudonensis SAM/SAH riboswitch
 RS: URS00021EDCF4_12908
MFE: -18.497
Ligand: SAM
Species: unclassified sequences SAM-SAH-Weickhmann-2018 RNA
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA085857 URS0000B74E45_1673631 URS0000B7EAE9_1529041 URS00021EDCF4_12908
Length 47. 47. 48. 46.
Similarity - 0.989 0.989 0.988
Ensemble Norm 0.875 - - -
MFE -15.702 -16.067 -16.138 -18.497
Ligands - SAM SAM SAM
Gene PTAR1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4. 4. 0.007
Length SE - 0. 1. 1.
Lev Distance - 13. 12. 15.
UBS 4. 4. 4. 4.
BS 0. 0. 0. 0.
ILL 0. 1. 1. 0.
ILR 0. 1. 1. 0.
H 2. 2. 2. 2.
BL 2. 1. 1. 2.
BR 2. 1. 1. 2.
UN 0.106 0.106 0.125 0.022

Sequences

Field Description
UTR seq + 25 aacugucgcggccgccgccaacATGGCCGAGACCAGCGAGGAGGTGG
UTR dot + 25 ….(((.((((((………)))))).)))((.(…..).)).
RS 1 seq AACCCGUCACAACGGCUUCCUGGCGUGACGGCGUCAUCAUUGGAGCA
RS 1 dot ….((((((..(((….)))..))))))((.(((….))).)).
RS 2 seq UUCCCGUCACAACGGCUUCCUGGCGUGGCGGACGUACCCAACGGAGCA
RS 2 dot …(((((((..(((….)))..)))))))..((.((….)).)).
RS 3 seq CCGCCACGACGGCUUCCUGACGUGGUGGGCUAUAUGUAUUGGAGCA
RS 3 dot ((((((((.(((….))).))))))))(((.((…..)).))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table