Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA085991 Similarity: 0.960 Similarity: 0.959 Similarity: 0.958
UTR: 5HSAA085991
Gene: PTCH1
MFE: -60.857
ENS: 0.942
Length: 170.
Predicted Ligands:
Mg2+ - 16/20
glucosamine - 1/20
lysine - 1/20
 RS: URS0000D79125_1834192
MFE: -30.697
Ligand: Mg2+
Species: Enterococcus sp. 9D6_DIV0238 M-box riboswitch (ykoK leader)
 RS: URS0000C6A42B_157838
MFE: -44.075
Ligand: Mg2+
Species: Bacillus shackletonii M-box riboswitch (ykoK leader)
 RS: URS0000C4E44F_2064
MFE: -71.548
Ligand: Mg2+
Species: Kitasatospora griseola M-box riboswitch (ykoK leader)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA085991 URS0000D79125_1834192 URS0000C6A42B_157838 URS0000C4E44F_2064
Length 170. 169. 169. 172.
Similarity - 0.960 0.959 0.958
Ensemble Norm 0.942 - - -
MFE -60.857 -30.697 -44.075 -71.548
Ligands - Mg2+ Mg2+ Mg2+
Gene PTCH1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7. 10. 17.001
Length SE - 1. 1. 4.
Lev Distance - 50. 49. 43.
UBS 10. 11. 11. 13.
BS 0. 0. 0. 0.
ILL 1. 1. 2. 3.
ILR 1. 3. 3. 3.
H 5. 5. 5. 5.
BL 4. 3. 2. 4.
BR 3. 2. 3. 3.
UN 0.135 0.142 0.148 0.099

Sequences

Field Description
UTR seq + 25 acccaggagggcugugcugauagcacguuccucgaguuuacuuugcuuuccuugaguuuauuguaaagggguaaaguuuucggauccgucacgugacccugacagguccugccuauggcgcggcagaccacccacgccgagggccATGGGGAAGGCTACTGGCCGGAAAG
UTR dot + 25 ……(((((.((((((…)))))).)))))……((((((((..((((…………))))))))))))….(((((.((((……..)))).)))))(.((((((((.((((………..))))…)))))))).).((((…))))……
RS 1 seq AUAAAUACUUGUUAGGUGAGGCUCCUAUGUAAACACAGGCUGCUGCUCAGAAAUGUCGAAAGACAGGUACGGGUAGGACAAAAAUCGUCGAAUUAAGGCGUUUUUCUAAGCAGCUAAAAGCAAUGCUUUUUACGUUAUAUAGUGCUAAAACUCAACGAAGAGAAGAACU
RS 1 dot …….(((((((((…….))))…….))))).(.((((((…..((((….))))…..)))))).)..((((.((((…….)))).))))…((((.((((((((…)))))……….)))))))….(((……)))…….
RS 2 seq UACGUGUUCUGUUAGGUGAGGCUCCUGUAUAGAGAUAAGCUGCUGCCCAAAAAUGUCGAGAGACGCCAAUGGGUCAACAGGAAAGAUCGGAAUAAGGUCUUUCUUAAUGUAGCUGGUACCAGAUUACCUAUGCUAUACAGUGCUAAAGCUCAAGCGAGGGAAACGGAGG
RS 2 dot ……((((((((((…….)))).))))))…..(((.((((((….((((….))))….)))).)).)))((((((((…….))))))))….((((((.((((……))))…))))))(..((((……..))))..)……….
RS 3 seq CAGACACCUCGUUCGGUGAGGCGUCUUCACGGACACAGGCCACUGAUCCCACCCGUCGAGAGACGCUCCGGAUCAGGACAGGUCUCCCCGGCCCAAGGGGUGACCCCAAGUGGCUUCCCCUGACCGGGGACACGCCGUGGAGUGCCAAAGCUCUGACGAGUAGGGGUGCGCC
RS 3 dot ……(((.((((.((((((…)))))).)).)))))…(((((((….((((….))))….)))))))….((((.((((…….)))).))))(((..((((.(((((…..)))))…))))))).(((((…((((….))))…)))))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table