Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA086179 Similarity: 0.972 Similarity: 0.970 Similarity: 0.970
UTR: 5HSAA086179
Gene: PTK2
MFE: -19.504
ENS: 0.834
Length: 125.
Predicted Ligands:
cobalamin - 8/20
molybdenum - 3/20
glycine - 3/20
 RS: URS0000D9074A_1968529
MFE: -33.451
Ligand: molybdenum
Species: Candidatus Aminicenantes bacterium 4484_214 Moco (molybdenum cofactor) riboswitch
 RS: URS0000DA0BFE_512030
MFE: -43.804
Ligand: glycine
Species: Acidovorax sp. NO-1 Glycine riboswitch
 RS: URS00023302B4_207949
MFE: -33.507
Ligand: cobalamin
Species: Bermanella marisrubri Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA086179 URS0000D9074A_1968529 URS0000DA0BFE_512030 URS00023302B4_207949
Length 125. 125. 127. 125.
Similarity - 0.972 0.970 0.970
Ensemble Norm 0.834 - - -
MFE -19.504 -33.451 -43.804 -33.507
Ligands - molybdenum glycine cobalamin
Gene PTK2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7.002 5.008 8.013
Length SE - 0. 4. 0.
Lev Distance - 35. 33. 37.
UBS 7. 8. 8. 8.
BS 0. 0. 0. 0.
ILL 2. 4. 3. 2.
ILR 3. 4. 3. 4.
H 2. 1. 1. 3.
BL 2. 2. 3. 0.
BR 1. 1. 2. 0.
UN 0.168 0.208 0.079 0.056

Sequences

Field Description
UTR seq + 25 acguaaauuuuaagaaacuuguugggaugguuguguucuaaaguuaaggaaucaaggaugaugucaagaauaugacagauaccuagcaucuagcaaaauaATGAGGATGGAGTCCAGAAGACAGG
UTR dot + 25 ……(((((.(((….(((((((((.((((((((((…((((…………))))….))))))))))..)).))))))))))…)))))…..((((…))))……….
RS 1 seq CGUUAAUUUAGUCUCCGAGUUGAAAAGGCUACCGUCUGUCCCCAGACCAUGCCCUACAACCGAAAGGGUUAAGCUGGAAACGGCUUGGCCUCCCAGCUUUGGAAAGGAGAAAAGAUGAAAAGUAA
RS 1 dot ………..(((((((((((…((((((..(.((((..((((.(…(((((………)))))…)))))..))))).))))))..))))))……)))))……………
RS 2 seq CGUUCCCUUGCUGGAGAGAGAUGGCCCGCCGCACCGCGUUAUGAGGCCAUCCACCGAAGGAGCAAACCGCACGGCCAGCCAGGGCAGUGGGGCGAAUCUCUCAGGUAAAGCGGACAGCAGGGCAAAU
RS 2 dot …..((((((((((((((..((.(((((.((.((..(((….((((……………………)))))))..)))).))))).))..))))))…………))))))))…..
RS 3 seq AACGAGUGUCUUGGUACUAUUGUCUAAGACCUCAGGGAACCUAGUGAGAUUCUAGGGCUGUACCCGCAACUGUGAGUAUGUUUUAGACGUACCAGCCAGAUACCUGAAGUUAGCCCAAGCAUGGA
RS 3 dot …..((((((((((((….((((((((((((((((..(((((…….)))))……)))…….))))…)))))))))))))))…))))))(((….))).(((….))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table