Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA086271 Similarity: 0.976 Similarity: 0.975 Similarity: 0.975
UTR: 5HSAA086271
Gene: PTMA
MFE: -41.214
ENS: 0.775
Length: 107.
Predicted Ligands:
TPP - 13/20
guanidine - 3/20
cobalamin - 2/20
 RS: URS0000DB3BFA_1121131
MFE: -25.465
Ligand: TPP
Species: Butyrivibrio fibrisolvens DSM 3071 TPP riboswitch (THI element)
 RS: URS0000D9FE21_546364
MFE: -48.439
Ligand: TPP
Species: Amycolatopsis australiensis TPP riboswitch (THI element)
 RS: URS0000C34B1E_281362
MFE: -32.396
Ligand: TPP
Species: Dechloromonas denitrificans TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA086271 URS0000DB3BFA_1121131 URS0000D9FE21_546364 URS0000C34B1E_281362
Length 107. 106. 108. 107.
Similarity - 0.976 0.975 0.975
Ensemble Norm 0.775 - - -
MFE -41.214 -25.465 -48.439 -32.396
Ligands - TPP TPP TPP
Gene PTMA - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 14.001 5.009 4.001
Length SE - 1. 1. 0.
Lev Distance - 25. 30. 32.
UBS 8. 8. 9. 8.
BS 0. 0. 0. 0.
ILL 2. 4. 3. 1.
ILR 2. 3. 3. 1.
H 2. 2. 3. 3.
BL 3. 0. 3. 3.
BR 3. 3. 2. 2.
UN 0.131 0.104 0.037 0.103

Sequences

Field Description
UTR seq + 25 gggaccgcuaugccgugcggggcccgcgggcugucccacucgagggcuggagccggcaucgcgcaucgaguccgcuugauacATGTCAGACGCAGCCGTAGACACCA
UTR dot + 25 .(((((((.((((((.((..(((((.((((……..)))).)))))…)))))))).)))……))))……….((((..(((….))).))))…
RS 1 seq AAUUAAACAAACGGGAGCUUUUGUGAAAGGCUGAGAGGAAGGUUAGACCUUCGACCGAGAACCUGAUUUGGAUAAUGCCAACGUAGGGAUGCCCAUUUCUAUUGAU
RS 1 dot .((((..((((((((..(((..((..((((((((……..)))).))))..)).)))..)))).))))..))))……((((((((….))))))))….
RS 2 seq CACGGUUGCCACGGGAGUCCGGUGAGCCGGGCUGAGAGGCGGGUCACCCCGCGACCGUUCGCACCUGACCGGAUCAUGCCGGCGAAGGGAGGGCUUUCCCCUCCUCGU
RS 2 dot ..(((.(((.((((..((..(((((.(((……….))).)))))..))..))))..))).))).((((……))))(((..((((((…..))))))))).
RS 3 seq UCCACUCGUUAGGGGUGUCGAGCGCCGUUUGCUGUGGCGGUCGACUGAGAAAUACCCUUCGAACCUGACCGGGUCAUGCCGUCGUAGGGAAACGAACUUUGUUGCUC
RS 3 dot …..(((..(((((((((((.(((((…….))))).)))))……..)))))))))….((.(((……)))))((((.(((……))).))))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table