Detected as a riboswitch by 14 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA086367 Similarity: 0.971 Similarity: 0.970 Similarity: 0.968
UTR: 5HSAA086367
Gene: PTPN13
MFE: -34.331
ENS: 0.892
Length: 124.
Predicted Ligands:
TPP - 11/20
cobalamin - 4/20
glycine - 2/20
 RS: URS0000D9F1C2_474394
MFE: -27.717
Ligand: glycine
Species: Vibrio mangrovi Glycine riboswitch
 RS: URS0000AB9723_12908
MFE: -29.354
Ligand: cobalamin
Species: unclassified sequences AdoCbl variant RNA
 RS: URS0000DB092B_1802198
MFE: -37.773
Ligand: molybdenum
Species: Spirochaetes bacterium RIFOXYC1_FULL_54_7 Moco (molybdenum cofactor) riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA086367 URS0000D9F1C2_474394 URS0000AB9723_12908 URS0000DB092B_1802198
Length 124. 125. 126. 122.
Similarity - 0.971 0.970 0.968
Ensemble Norm 0.892 - - -
MFE -34.331 -27.717 -29.354 -37.773
Ligands - glycine cobalamin molybdenum
Gene PTPN13 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.003 2. 11.006
Length SE - 1. 4. 4.
Lev Distance - 37. 34. 34.
UBS 8. 9. 8. 9.
BS 0. 0. 0. 0.
ILL 1. 2. 1. 4.
ILR 3. 3. 2. 4.
H 2. 2. 2. 2.
BL 2. 2. 2. 2.
BR 3. 3. 2. 3.
UN 0.089 0.032 0.103 0.164

Sequences

Field Description
UTR seq + 25 agcucccucgcagaaaauggggcaaucggguuuguuuucaaggcaggaccugaacaaaauguaggacaccugaucugugggaugaagggcgcugguaauATGCACGTGTCACTAGCTGAGGCCC
UTR dot + 25 ……((((((((…(((((((.((((((((((((…)))))).))))))……)))……)))).))))))))…..((((((((((.((((….)))).))))))….))))
RS 1 seq GUGAAGACUACAGGAGAGAGGCUGUUAACCUAAUAUUAACAUUAAGGUUGGCAUAUCCCGCCGAAGAAGUAAAUCUUUCAGGUGUAUCACUCUGCUUUUGAGUAUACGAGGACUGUAGUUGGAGG
RS 1 dot ((((..((.((..(((((((((((((((((((((……)))).))))))))……)))………..))))))..)))).))))….(((((((.((((…….)))).)))))))
RS 2 seq UAAAUAAGUUUAUAUGUGAUGAAGUAGAGUGAAAUUCUCUCACUGUCGCGCAACGGUUAAAGUCCGAACUCACGUAUAAGCUAAAGACGUAGCUAGGCUCGCGGAAAGCUAAGCAGUUACUCAAAA
RS 2 dot ……(((((((((((((((((((((((…….)))).))).)))…………………)))))))))))))…((.((((((..(((.((…..))..)))))))))))….
RS 3 seq UCAGCCACGUUCCUUCGAGCCUUUGCGCCUACCGGCUUCAUGCCCAUGGUGCUCAGGCCAUUGGGCCGCUGUGGAAACACCGUGACCUUCCACCUUUGAAAAGGAGGAAACGCAAUGCUCGU
RS 3 dot ….((((((.(((….((((..(((((….(((…..)))…)))))..))))….)))..)).))))…….(((…((((.((((….)))).)))).)))………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table