Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA086435 Similarity: 0.995 Similarity: 0.994 Similarity: 0.994
UTR: 5HSAA086435
Gene: PTPN3
MFE: -4.259
ENS: 0.987
Length: 45.
Predicted Ligands:
SAM - 19/20
Ni/Co - 1/20

 RS: URS00021EE0C4_12908
MFE: -13.038
Ligand: SAM
Species: unclassified sequences SAM-SAH-Weickhmann-2018 RNA
 RS: URS0000C49209_407035
MFE: -6.899
Ligand: Ni/Co
Species: Salinicoccus halodurans PreQ1 riboswitch
 RS: URS00021EDEB4_12908
MFE: -12.596
Ligand: SAM
Species: unclassified sequences SAM-SAH-Weickhmann-2018 RNA
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA086435 URS00021EE0C4_12908 URS0000C49209_407035 URS00021EDEB4_12908
Length 45. 45. 45. 45.
Similarity - 0.995 0.994 0.994
Ensemble Norm 0.987 - - -
MFE -4.259 -13.038 -6.899 -12.596
Ligands - SAM Ni/Co SAM
Gene PTPN3 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3. 2. 3.002
Length SE - 0. 0. 0.
Lev Distance - 6. 7. 7.
UBS 3. 3. 3. 3.
BS 0. 0. 0. 0.
ILL 0. 1. 1. 1.
ILR 1. 1. 0. 1.
H 1. 1. 1. 1.
BL 1. 0. 1. 0.
BR 0. 1. 0. 1.
UN 0.311 0.311 0.311 0.356

Sequences

Field Description
UTR seq + 25 cagguuauucagcgauaguuATGGATATTTGCGAAGGAAGGTTAA
UTR dot + 25 (((((.(((((((….))..))))))))))…………..
RS 1 seq GUAGCUGCAACGGCUUCCUGGCGCAGCUUGCAUUUAAUUGGAGCA
RS 1 dot ((((((((..(((….)))..)))))).))…………..
RS 2 seq UUAUCACAGGUUCGAGAUCCUCCCUGUAUAAAAAACUAAGGAGAU
RS 2 dot ((((.(((((…(((…))))))))))))…………..
RS 3 seq CCCGCACAACGGCUUCCUGGCGUGCGUGGAUAACCCAACGGAGCA
RS 3 dot (((((((..(((….)))..))))).))…………….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table