Detected as a riboswitch by 7 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA086436 Similarity: 0.973 Similarity: 0.972 Similarity: 0.970
UTR: 5HSAA086436
Gene: PTPN3_0
MFE: -15.730
ENS: 0.815
Length: 118.
Predicted Ligands:
SAM - 5/20
TPP - 4/20
molybdenum - 3/20
 RS: URS0000C107A9_690567
MFE: -23.548
Ligand: molybdenum
Species: Syntrophomonas zehnderi OL-4 Moco (molybdenum cofactor) riboswitch
 RS: URS000232EDB8_43658
MFE: -26.097
Ligand: cobalamin
Species: Pseudoalteromonas rubra Cobalamin riboswitch
 RS: URS0000ABBC50_533247
MFE: -28.885
Ligand: guanidine
Species: Raphidiopsis brookii D9 Guanidine-I riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA086436 URS0000C107A9_690567 URS000232EDB8_43658 URS0000ABBC50_533247
Length 118. 119. 119. 117.
Similarity - 0.973 0.972 0.970
Ensemble Norm 0.815 - - -
MFE -15.730 -23.548 -26.097 -28.885
Ligands - molybdenum cobalamin guanidine
Gene PTPN3 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6. 7.008 4.001
Length SE - 1. 1. 1.
Lev Distance - 33. 34. 38.
UBS 8. 9. 7. 7.
BS 0. 0. 0. 0.
ILL 1. 1. 1. 1.
ILR 2. 4. 3. 1.
H 2. 2. 2. 3.
BL 4. 5. 3. 3.
BR 2. 2. 0. 2.
UN 0.220 0.218 0.311 0.188

Sequences

Field Description
UTR seq + 25 acagaaaggcgcucuaggauccgcaggaaggcaggugugagaugagacggaggugggaagcaggagcacagaucagguuauucagcgauaguuATGGATATTTGCGAAGGAAGGTTAA
UTR dot + 25 ……..(.(((((.(..(((.((……………………….)))))..).))))).)….((((.((((((((….))..))))))))))…………..
RS 1 seq UAAUUAAAUAGUCUCCGAACUGUAAGCCUAACGCCAAUCAGCUAUGGCAAGCAGUCCUUAGGGUAAUUUCGGAAACGUAUCUACCUCCCAUUGCGGAAAGGAGACAUGAACUUAACGGC
RS 1 dot ………….((((((((.((((.((…((((……..))))….))..)))).)))….)))))..(((.(((.(((.((…..))..)))))).)))………..
RS 2 seq CUAGAAUCGUAUUGUAUUGGCAGUCAUUGGGAAUGAGGUGCAAACCCUCAGCUGUCCCCGCAACUGUAAUGGACUUUUGGUCUGAAGCCAGAUACCAAGGCCAAUACCUACACUUAAGC
RS 2 dot ……………….(((((….((((.(((((…….)))))….))))….)))))..(((.(.(((((((((….))))..)))))))))…………….
RS 3 seq ACAAAUAGCCUCUAGGGUUCCGGUUUUUAAUUACCAAACAAAAUGCAGGUCCGAGAGAGGCAAGUUAUUUUCUAGUAUUAGAGAGUAACUACACGGAGGGAAAAAAGCCCGGGAGAA
RS 3 dot …….((((((.(((..((.((.(((…………))).)).)))))…)))))).((((((((((((….))))))))))))…….(((…….)))…….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table