Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA086439 Similarity: 0.966 Similarity: 0.966 Similarity: 0.965
UTR: 5HSAA086439
Gene: PTPN3_1
MFE: -59.669
ENS: 0.971
Length: 144.
Predicted Ligands:
TPP - 12/20
FMN - 4/20
cobalamin - 2/20
 RS: URS0000C091A6_1736395
MFE: -51.523
Ligand: TPP
Species: Arthrobacter sp. Soil736 TPP riboswitch (THI element)
 RS: URS0000C7F7AD_356829
MFE: -46.911
Ligand: FMN
Species: Bifidobacterium tsurumiense FMN riboswitch (RFN element)
 RS: URS0000D90C35_1227262
MFE: -61.648
Ligand: TPP
Species: Actinomyces johnsonii F0510 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA086439 URS0000C091A6_1736395 URS0000C7F7AD_356829 URS0000D90C35_1227262
Length 144. 144. 145. 145.
Similarity - 0.966 0.966 0.965
Ensemble Norm 0.971 - - -
MFE -59.669 -51.523 -46.911 -61.648
Ligands - TPP FMN TPP
Gene PTPN3 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6.026 12.019 3.002
Length SE - 0. 1. 1.
Lev Distance - 43. 39. 45.
UBS 11. 10. 10. 12.
BS 0. 0. 0. 0.
ILL 1. 1. 2. 1.
ILR 3. 3. 2. 3.
H 4. 3. 4. 5.
BL 5. 5. 2. 5.
BR 1. 3. 1. 2.
UN 0.083 0.243 0.221 0.131

Sequences

Field Description
UTR seq + 25 acugggcaugcucagacggcggccaggucgcgccgcgagcgagcuuccgcgccgcccgcacgcgcgaccuaccugggcgcuccgcgcccccggaugcugcagguuauucagcgauaguuATGGATATTTGCGAAGGAAGGTTAA
UTR dot + 25 ….(((.((((…..)))))))(((((((((.(((.(((.((……))))).)))..)))))))))….((((((…))))))((……((((((.((((((((….))..))))))))))))……))….
RS 1 seq UUAUUACGACAGGGGAGCGCCGCCGUCGGGGAUCACUGGCAACUGCCAGCCGAACCUUGGAUGGGCGCUGAGAGUGCGGACAGCCGCAGACCCUCGAACCUGAUCCGGCUAGUACCGGCGUAAGGGAGUCGAGUUCUCAAAGUG
RS 1 dot ……………((((((.(..((((((.((.(((((….)))))..)).))))))..)))))))…..(((((….)))))….(((((.(((.((((((……)))).)).)))…)))))………..
RS 2 seq GGCAAGUUUCAGGGAAGGUGCAAUUCCUUACUGGCGGUGACAGAAGUUGGUCACAUUCACUUCUGCAGCCCGCGAGCCGUGCAAACGGCAGAUACCGGUGUGAGUCCGGAGCCAACGGUCACAGUCCGGAUGAAAGAAACGGAGC
RS 2 dot ………(((..((((…….)))).)))((((((.((((((.(((……)))))))))))..))))..(((((….)))))…..(((((((((..(((…….))))))))..))))…………….
RS 3 seq CUGCAACGACAGGGGAGCGCCCCGUCGUCGGCCCGGCCGCGAUUGGCCGAUGGGUCGCCGCCGACGGCGCUGAGAGUGCGGAAGCCCGCAGACCCUCGAACCUGCUCCGGUUAGCACCGGCGAAGGAAGUCGAGACCAUCUCCCC
RS 3 dot …..(((((.((((….)))))))))((((((((((……))))…)))))).((((…))))..(.(..(((((….)))))..))(((((.(((.(.(((((….))))).).)))…)))))………..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table