Detected as a riboswitch by 5 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA086571 Similarity: 0.981 Similarity: 0.980 Similarity: 0.980
UTR: 5HSAA086571
Gene: PTPRQ
MFE: -16.356
ENS: 0.823
Length: 87.
Predicted Ligands:
guanidine - 7/20
cyclic-di-GMP - 7/20
SAM - 4/20
 RS: URS00021EDC2F_12908
MFE: -28.060
Ligand: guanidine
Species: unclassified sequences guanidine-IV riboswitch
 RS: URS0000C55B84_1734398
MFE: -17.044
Ligand: cyclic-di-GMP
Species: Gracilibacter sp. BRH_c7a Cyclic di-GMP-II riboswitch
 RS: URS0000C7C97C_1423775
MFE: -19.092
Ligand: SAM
Species: Lactobacillus nodensis DSM 19682 = JCM 14932 = NBRC 107160 SMK box translational riboswitch (SAM-III)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA086571 URS00021EDC2F_12908 URS0000C55B84_1734398 URS0000C7C97C_1423775
Length 87. 87. 87. 87.
Similarity - 0.981 0.980 0.980
Ensemble Norm 0.823 - - -
MFE -16.356 -28.060 -17.044 -19.092
Ligands - guanidine cyclic-di-GMP SAM
Gene PTPRQ - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.003 5.016 2.005
Length SE - 0. 0. 0.
Lev Distance - 25. 25. 26.
UBS 4. 4. 4. 4.
BS 0. 0. 0. 0.
ILL 0. 0. 2. 1.
ILR 0. 0. 0. 0.
H 3. 2. 2. 3.
BL 0. 1. 0. 0.
BR 1. 2. 1. 0.
UN 0.356 0.299 0.230 0.287

Sequences

Field Description
UTR seq + 25 aaaagcccaaugggaucauuauugcuuaugaagugcuauauaaaaauauagauacuuuauauATGGATTTTCTTATCATTTTTCTTT
UTR dot + 25 …..(((…)))…………(((((((((((((((….)))))).)))))))))….(((……)))……….
RS 1 seq UUAUACUUGCCGCCGGGUAAGCACGUUUUUACGUUGGUUUUCGUAUCGUUAGGCCUUUGAAGAUACGAGAUACCAGCUUUUUUUAUG
RS 1 dot …..((((((….))))))………..(((((((((((((((.((((….)))).))))))))).))))))……….
RS 2 seq CUGAUAAAUGGAAGCUAUGAUAUGCUAUUAGAAAUUUGGGCACCUAUUAAUAGCAUGGAGCAAGUGGUGCAACCGACCAUUGAACUU
RS 2 dot ………….(((….(((((((((((…..(((….)))))))))))))).))).((((((…….))))))……
RS 3 seq AUCUAUUAAGAGGUUCCUGAUGGGAUCCUUUUUUUAUUGUGAUUAAUAAAAGGAGAAGCCCUGUAACCGAAAGGUGGAAAAAUUAUG
RS 3 dot ………..((((((….))))))((((((((((((….))))))))))))….((….(((….)))))……….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table