Detected as a riboswitch by 14 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA086603 Similarity: 0.959 Similarity: 0.959 Similarity: 0.957
UTR: 5HSAA086603
Gene: PTRH2
MFE: -42.850
ENS: 0.863
Length: 150.
Predicted Ligands:
FMN - 9/20
cobalamin - 7/20
molybdenum - 1/20
 RS: URS0002319657_1286094
MFE: -55.701
Ligand: cobalamin
Species: Streptomyces aurantiacus JA 4570 Cobalamin riboswitch
 RS: URS0000C414C1_1643452
MFE: -42.612
Ligand: FMN
Species: Bacillus sp. CHD6a FMN riboswitch (RFN element)
 RS: URS0000AB3AA9_399742
MFE: -52.767
Ligand: FMN
Species: Enterobacter sp. 638 FMN riboswitch (RFN element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA086603 URS0002319657_1286094 URS0000C414C1_1643452 URS0000AB3AA9_399742
Length 150. 149. 151. 151.
Similarity - 0.959 0.959 0.957
Ensemble Norm 0.863 - - -
MFE -42.850 -55.701 -42.612 -52.767
Ligands - cobalamin FMN FMN
Gene PTRH2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 5.002 2. 7.002
Length SE - 1. 1. 1.
Lev Distance - 51. 53. 53.
UBS 13. 12. 13. 13.
BS 0. 0. 0. 0.
ILL 5. 4. 5. 3.
ILR 3. 2. 3. 3.
H 3. 3. 4. 4.
BL 3. 4. 3. 4.
BR 5. 6. 4. 4.
UN 0.053 0.094 0.053 0.093

Sequences

Field Description
UTR seq + 25 ucgcuuugugauucuugauccggaacuugucacccaggaaccccggaagagguagcucacgcgauagaaacguguucgcugcccagaagaagggaaggcgcgagugaggaaaggagguacuguagATGATGCCCTCCAAATCCTTGGTTA
UTR dot + 25 ((((…(((((((((..(((((..((((…..))))….)))))..))).)).))))))))……(((.(((.((……….)).))).))).((.((((((..(((((….(((…..))))))))…)))))).)).
RS 1 seq GGGACUCUCCGGGCGACAAGUCCAUACAUCGAGGCGACGGUUGCCAGGAACCCGGUGCGACUCCGGGACGGUCCCGCCACUGUGACCGUACGCGCGAACCGCUCACGCGCGCACGGAAGUCAGGAACUGACCCGUCGUCCUCCUGCCAU
RS 1 dot ((((((.(((.((…..(((((((…((..(((((…)))))..))…..))).)))))).))).))))))……….((((.((((((………)))))).))))..(.(((((…(((…..))).))))).)..
RS 2 seq AAUGUCCUUCGGGGGUGGGUGAAAUUCCCUACCGGCGGUGAUGAAGCUUUAUGUUUCUUAGUCCGUGACCCGGUUUUCUUGAAUAGGAAAAGCGGUGGAUCUGGUGCAACUCCAGGGCCGACAGUUAAAGUCUGGAUGGGAGAAGGAUUAU
RS 2 dot …(((..(((..((((((.((…))))))))..))).)))(((((…..)))))…(((((….(((.(((((((….))))))).)))))))).((((.(..((((….(((((…….))).))…))))..).)))).
RS 3 seq GCUUAUUCUCAGGGCGGGGCGAAAUUCCCCACCGGCGGUAAAUCAGCCUUGCGCUGAAAGCCCGCGAGCGCUUUGGGUGAAAACCUAAAGGUCAGCAGAUCCGGUGUAAUUCCGGAGCCGACGGUUAGAGUCCGGAUGGGAGAGAGUAACG
RS 3 dot ((((….((((.(((((((((….((((…)).))….)).))))))).))))))))(.((..((.((((((((….))))))))))..)).).(((((…….))))).(((.(((…….)))..)))…………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table