Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA086605 Similarity: 0.977 Similarity: 0.976 Similarity: 0.975
UTR: 5HSAA086605
Gene: PTS
MFE: -43.484
ENS: 0.760
Length: 104.
Predicted Ligands:
TPP - 11/20
SAM - 5/20
glycine - 2/20
 RS: URS0000AB5EFF_608534
MFE: -25.910
Ligand: TPP
Species: Oribacterium sp. oral taxon 078 str. F0262 TPP riboswitch (THI element)
 RS: URS0000DAE111_1348163
MFE: -36.184
Ligand: TPP
Species: Desulfocarbo indianensis TPP riboswitch (THI element)
 RS: URS0000C89836_1700845
MFE: -31.801
Ligand: TPP
Species: Loktanella sp. 1ANDIMAR09 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA086605 URS0000AB5EFF_608534 URS0000DAE111_1348163 URS0000C89836_1700845
Length 104. 103. 104. 102.
Similarity - 0.977 0.976 0.975
Ensemble Norm 0.760 - - -
MFE -43.484 -25.910 -36.184 -31.801
Ligands - TPP TPP TPP
Gene PTS - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.002 2.001 3.001
Length SE - 1. 0. 4.
Lev Distance - 29. 32. 28.
UBS 9. 9. 9. 10.
BS 0. 0. 0. 0.
ILL 3. 4. 4. 4.
ILR 4. 3. 3. 4.
H 2. 2. 2. 2.
BL 3. 3. 3. 2.
BR 3. 3. 3. 3.
UN 0.058 0.097 0.029 0.088

Sequences

Field Description
UTR seq + 25 gcgcagccgcggugggaggaggcaccggccgcgcggcgggaggaggugccggccgagcaccgcagacagcgccgggaagATGAGCACGGAAGGTGGTGGCCGTC
UTR dot + 25 ((((.((.((((((…((.((((((..((((…))))…..))))))..))…)))))).).).))))……((((..(((……..)))..))))
RS 1 seq UAUUGUUGCUGGGGGCGCUGUAUGCUGAGAGGAUUCGAGCUUCGAAUCGACCCUUAUACCUGAUCCGGGUAAUGCCGGCGUAGGGAAGCAGUUUUUUUCGUGC
RS 1 dot ….((((((.((..((..(((((..(.(..(((((((…)))))))..))..))))).))..)).))))))……(((.(((((……))))).)))
RS 2 seq UGGGAUUGCUGGGGGAGCUUAACCGCUGAGAGUACGCCAUAGUGGCGUAGACCCCUGGAACCUGUUCGGGUAAUUCCAACGCAGGGAAGCGAUCCGGCGCUCUG
RS 2 dot ((((((((((.(((.((…..(((..(.(..(((((((…)))))))..))..)))…)).))).))))))))))…(((((..((……)).)))))
RS 3 seq AGGUCUACCUCGGGGGGCCAAUCAUGGCUGAGAUGCGACGCACGCGGACCCGUUGAACCUGAACCGGUUAAGACCGGCGGAGGGAAGGUAUGGCAAUCCCGC
RS 3 dot .(((((…(((((((..((((…(((((.(.(((…)))).))).)).))))..)))…))))…)))))……((((..((…))..))))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table