Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA086844 Similarity: 0.979 Similarity: 0.978 Similarity: 0.976
UTR: 5HSAA086844
Gene: PUS10
MFE: -27.130
ENS: 0.978
Length: 104.
Predicted Ligands:
TPP - 19/20
GMP - 1/20

 RS: URS0000BE8F3B_1317122
MFE: -26.638
Ligand: TPP
Species: Aquimarina atlantica TPP riboswitch (THI element)
 RS: URS0000D66DCF_12908
MFE: -42.220
Ligand: GMP
Species: unclassified sequences c-di-GMP-II-GAG riboswitch
 RS: URS0000ABB6E9_272623
MFE: -21.860
Ligand: TPP
Species: Lactococcus lactis subsp. lactis Il1403 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA086844 URS0000BE8F3B_1317122 URS0000D66DCF_12908 URS0000ABB6E9_272623
Length 104. 105. 103. 103.
Similarity - 0.979 0.978 0.976
Ensemble Norm 0.978 - - -
MFE -27.130 -26.638 -42.220 -21.860
Ligands - TPP GMP TPP
Gene PUS10 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4.004 7. 3.014
Length SE - 1. 1. 1.
Lev Distance - 26. 25. 30.
UBS 8. 7. 9. 7.
BS 0. 0. 0. 0.
ILL 3. 3. 1. 3.
ILR 3. 2. 3. 3.
H 2. 2. 2. 2.
BL 3. 2. 4. 2.
BR 3. 2. 2. 2.
UN 0.115 0.181 0.107 0.233

Sequences

Field Description
UTR seq + 25 uucccuucgagggccggaagggguuaaaucucaggcuccggcgucuggggagaaggugaggcgguuauaauuauucaauATGTTCCCACTGACTGAGGAAAACA
UTR dot + 25 ((((((..((..((((((.(((((…)))))….)))))).)).))))))..(((.((..((.((((………))))..))..)).)))……….
RS 1 seq AAAAUCUCAAAGGGGUGCUUUUUAAGUUUUAAAUGUAAAAGGCUGAGAUCAUACCCGAUGAACCUGGGCGAGUAAUGUUGCCAAGGGACUGUGGAACCAAAAAAG
RS 1 dot …((((((…….((((((((.(((…))).))))))))))))))…..(((..(..(((.(((((……))))).)))..)..)))………..
RS 2 seq GAUCUGGGGGGUGGCAGCGGACCGCGAGGUCCAACCAGCGCGGCGUCCUGAUCCGGUCGCCAAACCGUCGUGCUGGGCCAAUGGCGAGACCGACCCGUCGAUC
RS 2 dot ((((.((((.((.((.(((((((….)))))…..)))).)).))))))))(((((((((….(((……)))…))))..)))))………..
RS 3 seq CAAUAACACAAUGGGUACUGGUAAAAACUAAAAUUACCGGUUGAGAAAGACCAUCAGACUUGAACAGGUUAAGACCUGCGUAAGAAUGUGUCCGAGUUUUAAU
RS 3 dot ……..((((.((((.((((….))))….)))).))))…..(((…((..((((..(((((….)))))..))))..)).)))………..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table