Detected as a riboswitch by 18 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA086849 Similarity: 0.987 Similarity: 0.987 Similarity: 0.986
UTR: 5HSAA086849
Gene: PUS10_1
MFE: -9.788
ENS: 0.934
Length: 61.
Predicted Ligands:
fluoride - 15/20
unknown - 5/20

 RS: URS0000E5FA81_1109412
MFE: -17.670
Ligand: unknown
Species: Brenneria goodwinii nhaA-I RNA
 RS: URS0000D668CB_12908
MFE: -18.342
Ligand: unknown
Species: unclassified sequences nhaA-I RNA
 RS: URS0000DACC0D_1895812
MFE: -13.237
Ligand: fluoride
Species: Rhizobiales bacterium 63-22 Fluoride riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA086849 URS0000E5FA81_1109412 URS0000D668CB_12908 URS0000DACC0D_1895812
Length 61. 61. 61. 61.
Similarity - 0.987 0.987 0.986
Ensemble Norm 0.934 - - -
MFE -9.788 -17.670 -18.342 -13.237
Ligands - unknown unknown fluoride
Gene PUS10 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 8.001 6.002 3.045
Length SE - 0. 0. 0.
Lev Distance - 14. 16. 18.
UBS 6. 7. 5. 5.
BS 0. 0. 0. 0.
ILL 2. 1. 0. 2.
ILR 2. 1. 1. 1.
H 1. 1. 1. 1.
BL 2. 3. 2. 2.
BR 3. 5. 3. 2.
UN 0.016 0.049 0.066 0.230

Sequences

Field Description
UTR seq + 25 ggcuuuguuagcaaaggaggguuauaauuauucaauATGTTCCCACTGACTGAGGAAAACA
UTR dot + 25 (..(((.((((((..((((.((…………..)).))))…)).)))).)))..).
RS 1 seq GGGUGUCGGCUGUAUAGGGCAGUUAGGCAGGUUAUUAUCAUGCGUUGGUCGGGCCGCCGCG
RS 1 dot ..(((.((((((..(((.((((.(((……..))).).))).)))..))).))).))).
RS 2 seq GGGUGUCGGGUCAACAUAGGGUUGAUCUAGGGCAGGUAAUUGUGUUGGUCGGGCCGCCACG
RS 2 dot .((((((.((((((((((((.(((……..))).)..))))))))))).))).)))…
RS 3 seq AUGAUCGCAGGGAAUGGAGUCUCCCGCAGACCGCGCCACCGCUGAUGACUCCUGCCAAUGG
RS 3 dot ………((.(..((((((..(.((………….)).)..))))))).))…..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table