Detected as a riboswitch by 19 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA086859 Similarity: 0.976 Similarity: 0.976 Similarity: 0.975
UTR: 5HSAA086859
Gene: PUS7L
MFE: -22.783
ENS: 0.922
Length: 114.
Predicted Ligands:
guanidine - 8/20
TPP - 6/20
glycine - 3/20
 RS: URS0000C4A6B2_1794906
MFE: -41.335
Ligand: guanidine
Species: Marinobacter sp. T13-3 Guanidine-I riboswitch
 RS: URS0000B74867_364030
MFE: -46.235
Ligand: glycine
Species: Thiomonas delicata Glycine riboswitch
 RS: URS0000C18302_1479237
MFE: -41.585
Ligand: guanidine
Species: Marinobacter sp. HL-58 Guanidine-I riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA086859 URS0000C4A6B2_1794906 URS0000B74867_364030 URS0000C18302_1479237
Length 114. 114. 114. 114.
Similarity - 0.976 0.976 0.975
Ensemble Norm 0.922 - - -
MFE -22.783 -41.335 -46.235 -41.585
Ligands - guanidine glycine guanidine
Gene PUS7L - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 8.004 3.017 10.004
Length SE - 0. 0. 0.
Lev Distance - 30. 32. 30.
UBS 7. 8. 7. 9.
BS 0. 0. 0. 0.
ILL 1. 1. 1. 1.
ILR 3. 2. 4. 2.
H 2. 3. 1. 3.
BL 1. 3. 2. 3.
BR 2. 1. 2. 2.
UN 0.219 0.158 0.088 0.158

Sequences

Field Description
UTR seq + 25 augcgcacagcguugugcaaaugaaugccuuccacugaaccgagguagacggggucgaguuucuugcgcgauggcacuguuauagaagaATGTTTGAAGCGATTGGTTTTTTAG
UTR dot + 25 ……((((((((((((((..((((((((((.(((…….))).))..))))…)))).))))))))))…))))……………(((((…..)))))….
RS 1 seq ACAAUGGGUGACUAGGGUUCCGGUCCGGCGAAGACAGUCUCUUUCCCGGAUGGCUGGUCCGAGAGUCACCGACCUCUGGACGGGGUUACACGGCGGGACAAAAGCCCGGGAGAU
RS 1 dot ……(((((((.(((..(((((((((.(((((…..))))).))))…))))))))…)))))))((((((…..))))))……((((.(….)))))……
RS 2 seq GUCAACCUCACUGGAGAGCGGCACGCGCAUUGGCGUCGUGCCCACCGAAGGGGCAAGCCGCGGCGCCGAUGACGCCCGGUCAAUCUCUCAGGUACCAAGGACAGCGGGGCGUCG
RS 2 dot …..((((.((((((((.(((..(((((((((((((((((((…….))))…..)))))))))))).)))…)))…)))))…………))).))))…..
RS 3 seq ACAAUGGGUGACUAGGGUUCCGGUCCGGGCAGGCUUUAUUGAUCAGCCCGGAUGGCUGGUCCGAGAGUUACCGACCUCUGGGAGGUUACACGGCGGGACAAAAGCCCGGGAGAC
RS 3 dot ……(((((((.(((..(((((((((((.(((……).)).))))))…))))))))…)))))))((((((…))))))……((((.(….)))))……

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table