Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA086860 Similarity: 0.966 Similarity: 0.965 Similarity: 0.965
UTR: 5HSAA086860
Gene: PUS7L_0
MFE: -32.528
ENS: 0.978
Length: 129.
Predicted Ligands:
cobalamin - 5/20
FMN - 5/20
TPP - 4/20
 RS: URS0002323BFC_1193069
MFE: -31.277
Ligand: cobalamin
Species: Leptospira wolffii serovar Khorat str. Khorat-H2 Cobalamin riboswitch
 RS: URS0000C83BE4_755178
MFE: -23.133
Ligand: guanidine
Species: Cyanobacterium aponinum PCC 10605 Guanidine-I riboswitch
 RS: URS0000ABA936_1262757
MFE: -32.002
Ligand: FMN
Species: Blautia sp. CAG:37 FMN riboswitch (RFN element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA086860 URS0002323BFC_1193069 URS0000C83BE4_755178 URS0000ABA936_1262757
Length 129. 131. 129. 129.
Similarity - 0.966 0.965 0.965
Ensemble Norm 0.978 - - -
MFE -32.528 -31.277 -23.133 -32.002
Ligands - cobalamin guanidine FMN
Gene PUS7L - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4. 11.012 8.014
Length SE - 4. 0. 0.
Lev Distance - 39. 44. 45.
UBS 5. 6. 7. 7.
BS 0. 0. 0. 0.
ILL 1. 0. 2. 1.
ILR 0. 0. 2. 1.
H 4. 5. 3. 5.
BL 0. 1. 1. 1.
BR 0. 0. 0. 1.
UN 0.279 0.260 0.171 0.163

Sequences

Field Description
UTR seq + 25 aauuacgccccugucggaggcugaaacacuuaaggcuuccgggcaugcgcacagcguugugcaaaugaaugccuuccacugaaccgaggcacuguuauagaagaATGTTTGAAGCGATTGGTTTTTTAG
UTR dot + 25 ……((((…..(((((((………..))))))))))).((((((……))))))……((((((……….))))))……………….(((((…..)))))….
RS 1 seq CAUUUUUAAGCACCUCACCGAGCCUAGUCUUAAUUCCGGGAGGAAUGGGGUGAGAAUCCCCAACUGACGGCGCAACCGUAAUAGAGAACAUUAUCUCUUAAGUCGGAUCUUCCCAUGAAUGGAUCGCCCGU
RS 1 dot …………((((.(((…………….)))))))..(((((…….)))))….((((…..))))…(((((……)))))…….(((((……….)))))……
RS 2 seq AAAGAAGGUUUCUAGGGUUCCGAUGCUUAAGGCGUGACUGGUCCGAGAGAAACAAGCUACUAUAAAGGAUUUUUUAUUUAGUUGACUACAAAUUAGGUAGCUACACGGAGGGAGAAAAGCCCGGGAGGA
RS 2 dot …….((((((.(((..((((((((…)))))…))))))…)))))).(((((((……………..(((((…….))))))))))))…….(((…….)))…….
RS 3 seq GGAGAUCUUCAGGGCAGGGUGUGAUUCCCUACUGGCGGUAUAGUCCGCGACCCGCUGCGAUAUCAAACAGCGGCUGACUCGGUGCAACUCCGGGACCAACAGUUAAAGUCUGGAUGAAAGAAGAUGAAA
RS 3 dot ………(((…((((…….)))).)))((((……))))…((((((……….))))))(((.(((((…….)))))…..)))…..((((……….))))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table