Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA086861 Similarity: 0.980 Similarity: 0.978 Similarity: 0.976
UTR: 5HSAA086861
Gene: PUS7L_1
MFE: -15.122
ENS: 0.931
Length: 100.
Predicted Ligands:
TPP - 10/20
purine - 5/20
glycine - 2/20
 RS: URS0000C50993_348802
MFE: -19.985
Ligand: TPP
Species: Exophiala xenobiotica TPP riboswitch (THI element)
 RS: URS000231244B_653045
MFE: -44.429
Ligand: zmp-ztp
Species: Streptomyces violaceusniger Tu 4113 ZMP/ZTP riboswitch
 RS: URS0000C7A632_28042
MFE: -30.464
Ligand: TPP
Species: Saccharopolyspora rectivirgula TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA086861 URS0000C50993_348802 URS000231244B_653045 URS0000C7A632_28042
Length 100. 100. 99. 98.
Similarity - 0.980 0.978 0.976
Ensemble Norm 0.931 - - -
MFE -15.122 -19.985 -44.429 -30.464
Ligands - TPP zmp-ztp TPP
Gene PUS7L - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 5.020 4.044 3.039
Length SE - 0. 1. 4.
Lev Distance - 25. 27. 27.
UBS 6. 7. 7. 7.
BS 0. 0. 0. 0.
ILL 1. 1. 1. 1.
ILR 2. 3. 2. 2.
H 2. 3. 3. 3.
BL 1. 2. 2. 0.
BR 2. 1. 1. 2.
UN 0. 0.160 0.091 0.102

Sequences

Field Description
UTR seq + 25 gugcaaaugaaugccuuccacugaaccgagguagacggggucgaguuucuugcgcgauggcacuguuauagaagaATGTTTGAAGCGATTGGTTTTTTAG
UTR dot + 25 ((((((..((((((((((.(((…….))).))..))))…)))).))))))……………………..(((((…..)))))….
RS 1 seq UGGUAUGUGUAGGGGAGCUCAGAGGGUGAGGUUGAUCUGAGAAAUACCGGAGAACUUGAUCUGGAUAAUACCAGCGAAAGGACAUGCCUUCUUUGACGUC
RS 1 dot ((((((…((((.((.((((…..)))).))..))))….))))))………..((((……))))(((((((…..))))..)))…..
RS 2 seq CGUCCGGGCCGUGACUGGCGCUGAGGUGGAGCACCACCGGGGAGCGGUCUGACGAUCGGGAGGCCAUCGCUCCCGAGAAGGACGUCGACGGCGUCACCA
RS 2 dot (((.((((((((..((((.(((…….))).)))….)..))))))))))).(((((((…….)))))))….((((((…))))))….
RS 3 seq GGCAGUGACGCGGGGUGCCCGAACUGGUGCGGGCUGAGAUCACACCCGUUGAACCUGACCUAGGUCGUACUAGCGGAGGGACGUCAUGGUUCCGAACG
RS 3 dot (((((….((((((((((((……..)))))…….)).)))))…..))).))….((((….)))).(((((……)))))…..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table