Detected as a riboswitch by 17 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA086863 Similarity: 0.976 Similarity: 0.972 Similarity: 0.972
UTR: 5HSAA086863
Gene: PUS7L_2
MFE: -26.019
ENS: 0.901
Length: 118.
Predicted Ligands:
TPP - 9/20
FMN - 4/20
glycine - 3/20
 RS: URS0002316DE9_512564
MFE: -16.957
Ligand: FMN
Species: Mycoplasma crocodyli MP145 FMN riboswitch (RFN element)
 RS: URS0000BE2358_1410620
MFE: -47.766
Ligand: TPP
Species: Shinella sp. DD12 TPP riboswitch (THI element)
 RS: URS0000D8A59C_879274
MFE: -47.766
Ligand: TPP
Species: Shinella sp. HZN7 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA086863 URS0002316DE9_512564 URS0000BE2358_1410620 URS0000D8A59C_879274
Length 118. 117. 117. 117.
Similarity - 0.976 0.972 0.972
Ensemble Norm 0.901 - - -
MFE -26.019 -16.957 -47.766 -47.766
Ligands - FMN TPP TPP
Gene PUS7L - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 8.001 6. 6.
Length SE - 1. 1. 1.
Lev Distance - 28. 35. 35.
UBS 7. 5. 8. 8.
BS 0. 0. 0. 0.
ILL 2. 2. 4. 4.
ILR 3. 3. 3. 3.
H 2. 2. 2. 2.
BL 0. 0. 1. 1.
BR 2. 0. 2. 2.
UN 0.144 0.179 0.137 0.137

Sequences

Field Description
UTR seq + 25 aacacuuaaggcuuccgggcaugcgcacagcguugugcaaaugaaugccuuccacugaaccgagcuuuuacccuacgaaaggaaaaccuggaaATGTTTGAAGCGATTGGTTTTTTAG
UTR dot + 25 …….((((((((…((((((((…)))).))))….))).)))))…..((((((((((((………..(((….)))……….)))))..)))))))…..
RS 1 seq UUGUAGUUUUCUGACUUAGUGAAAGUCUAAACCGGAAGUUAAAGUCUUCGUACUUUUUUAAGCAUGAAUAGGUGAAAUUCCUAUACCGACAGUAAAGUCUGAAUGAAGAAAAUACAA
RS 1 dot …….((((((..((((…….))))..))))))……((((((((((((………..(((((…….)))))………)))))….)))))))……..
RS 2 seq AGCAUUCACCAGGGGGGUCCCGACAAGGGGCUGAGAUACUGCUGGCAUUCGCAGCGCAGUGACCCGUUGAACCUGAUCCAGUUCAUACUGGCGUAGGGACGGUGCAAGCGCUGUAGA
RS 2 dot ……..((((.((((((((…..))))))……)).))))…..(((((((..((..(((((…((((..(((((….)))))..)))))))))..)).)))))))…
RS 3 seq GGCAUUCACCAGGGGGGUCCCGACAAGGGGCUGAGAUACUGCUGGCAUUCGCAGCGCAGUGACCCGUUGAACCUGAUCCAGUUCAUACUGGCGUAGGGACGGUGCAAGCGCUGUAGA
RS 3 dot ……..((((.((((((((…..))))))……)).))))…..(((((((..((..(((((…((((..(((((….)))))..)))))))))..)).)))))))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table