Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA086864 Similarity: 0.927 Similarity: 0.927 Similarity: 0.924
UTR: 5HSAA086864
Gene: PUS7L_3
MFE: -57.728
ENS: 0.964
Length: 234.
Predicted Ligands:
cobalamin - 17/20
TPP - 1/20
glutamine - 1/20
 RS: URS000231E9AE_634177
MFE: -74.538
Ligand: cobalamin
Species: Gluconacetobacter xylinus NBRC 3288 Cobalamin riboswitch
 RS: URS000232F7A5_1848038
MFE: -73.451
Ligand: cobalamin
Species: Methylovorus sp. MM1 Cobalamin riboswitch
 RS: URS0002316AB2_1797365
MFE: -56.898
Ligand: cobalamin
Species: Bacteroidetes bacterium RIFCSPLOWO2_12_FULL_37_12 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA086864 URS000231E9AE_634177 URS000232F7A5_1848038 URS0002316AB2_1797365
Length 234. 234. 232. 233.
Similarity - 0.927 0.927 0.924
Ensemble Norm 0.964 - - -
MFE -57.728 -74.538 -73.451 -56.898
Ligands - cobalamin cobalamin cobalamin
Gene PUS7L - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 15.002 9.001 11.
Length SE - 0. 4. 1.
Lev Distance - 91. 87. 95.
UBS 12. 15. 13. 13.
BS 0. 1. 0. 0.
ILL 4. 5. 3. 5.
ILR 3. 3. 4. 5.
H 6. 6. 7. 7.
BL 1. 1. 2. 1.
BR 3. 5. 1. 1.
UN 0.090 0.137 0.116 0.103

Sequences

Field Description
UTR seq + 25 augcgcacagcguugugcaaaugaaugccuuccacugaaccgagguagacggggucgaguuucuugcgcgaugugcugguaauccgaauguggugguaacaguaagauuucgggaaaaagcacacaaacgugggaaaaggccucuuucugaaugccaagaaggaaaaguuauauauacagcuuuuacccuacgaaaggaaaaccuggaaATGTTTGAAGCGATTGGTTTTTTAG
UTR dot + 25 .((((((……))))))……((((((……….))))))…((((((…(((((((((…((((((…..((((((..((.((….)).))….))))))….))))))….))))))))).)))))).((((……..))))(((((((((……..))))))).))……..((((((((………………..))))))))..
RS 1 seq GCCUUCUAUAUAGUCAGUGGUUCCGUGCAAACGGAUGAAAAGGGAACACCGUUCCGCUUCGGCAGGGUCCGUCCCGGAAGCCAGUCGGUGGCUGCUCCCGCAACUGUAAGCGGUAUGGGGUCGUGUCGUCCAUUUUCUGAGGGGAAUGGGCCACUGUUGUGUCAGCAACGGGAAGGUAGACACGAUCUGCGAUAAUCCGUGAGCCAGGAGACCUGCCACUGUCGAUCUCACGGC
RS 1 dot (((..((……..)).)))(((((….)))))………….((((.(((((((((..(((..((((((((…….)))).))).)..)))….))).)))))).))))(((((((((((((((((((….))))))))))..(((((((….)))))))…….)))))))))………(((((((…(..(((……..)))..)))))))).
RS 2 seq AUAUAGUGGAGCCACUACGGUCCUCACAGACAUUUCUAAAUGUGAGUUAAAAGGGAAUCCGGUAAAGGGUAUUCAAAAAGAUGAAUAUUCUAAAGCCGGGGCUGCCCCCGCAACUGUAAUCAGCCACCAGUUUUAGGACUGGUCGCUCGGGCAACAUGCCACUGGAUAUAUCCGGGAAGGCUGUCUGAGUGAAGCUGAAAGCCAGGAGACCUGCCGUGGAUAUUUUUCGUAA
RS 2 dot …(((((….)))))…..((((((…………))))))…………(((((..((((((((((……))))))))))…)))))(((((…..((….))…))))).((((((….))))))(((((((((((….(((.(((((….)))))…))))))))))))))…(((((((((.(……..).)))….))))))…
RS 3 seq CCUUUGCAGGCAAUCAAAGGUGACAUCCUAUUUCUUUUCCAAGAAAUUAUUUGUCAUAAUAGGGAACCGGGUGAGAAUCCCGGAUAGUACCCGCUGCUGUAAACUCUAAAAAGUUUUAUGCUUACGCUGGAUGCUCAAUCCGGUAGCCACUGUUAAUCCUUUAAUUUAAAGAUAACGGGAAGGUGCAGAAAACGAGAGUAAGUCAGAAGACCUGCCUUUGAAUUUAUUUUUAU
RS 3 dot ((((((……..))))))(((((….(((((((….)))))))….)))))…..(((..(((((…….)))))……)))…((…(((((……)))))…))….(((((((…..))))))).(((.((((((…(((((…))))).))))))…)))………((((((((((..((((……))))..))))))))))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table