Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA087076 Similarity: 0.986 Similarity: 0.984 Similarity: 0.983
UTR: 5HSAA087076
Gene: PYROXD1
MFE: -24.757
ENS: 0.944
Length: 79.
Predicted Ligands:
zmp-ztp - 8/20
homocysteine - 4/20
cobalamin - 3/20
RS: URS0000D8FE12_106412
MFE: -34.707
Ligand: zmp-ztp
Species: Streptosporangium subroseum ZMP/ZTP riboswitch
RS: URS00023132DE_1798623
MFE: -18.049
Ligand: cobalamin
Species: Candidatus Levybacteria bacterium RIFCSPLOWO2_01_FULL_39_24 AdoCbl variant RNA
RS: URS0000D86B59_265960
MFE: -27.381
Ligand: fluoride
Species: Gluconacetobacter nataicola Fluoride riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA087076 URS0000D8FE12_106412 URS00023132DE_1798623 URS0000D86B59_265960
Length 79. 80. 80. 80.
Similarity - 0.986 0.984 0.983
Ensemble Norm 0.944 - - -
MFE -24.757 -34.707 -18.049 -27.381
Ligands - zmp-ztp cobalamin fluoride
Gene PYROXD1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.001 7.004 1.007
Length SE - 1. 1. 1.
Lev Distance - 17. 18. 21.
UBS 6. 6. 5. 6.
BS 0. 0. 0. 0.
ILL 1. 0. 0. 1.
ILR 0. 0. 2. 0.
H 2. 2. 2. 2.
BL 3. 4. 3. 3.
BR 2. 3. 1. 3.
UN 0.139 0.163 0. 0.225

Sequences

Field Description
UTR seq + 25 cagagucccguugcuccgccgcgauauucaguaaaccacugggaguccggcagcATGTTAGGAAAACGCTTTCCCAACA
UTR dot + 25 ………..((((..((((.(((.((((((…..)))))).)))))))))))((((.(((((….))))).))))
RS 1 seq CGUCUAAACCGUGACUGGCGCGUUGGGUGGAAGGACCACCGGGGAGCGAGUGGCGGAGGCCGUGCGCCUGGGUCUUCGCC
RS 1 dot ………….(((.((.(.((.(((((…..))))).))).)).)))((((((((((………))))))))))
RS 2 seq AUUUAGAUUUAAAGUUAGGUAAUCAUGGUGUAAAUCCAUGACUGUGCCGCAACUGUUAAAGUCAGAAAACUAACUUUAUU
RS 2 dot …………((((.((((.((((((…….))))))…))))..))))..((((((.((….)).))))))..
RS 3 seq AACGAACACGGCAAUGGAUUCUGCCGGACCAUGCUGGUCGAACCGCUGCCCGCAAGGGCGCUGAUGAUUCCUGCCCACUG
RS 3 dot ………((((.(((.(((.(((((……))))).)))))).))))…..(((((..((….)).)))))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table