Detected as a riboswitch by 9 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA087149 Similarity: 0.982 Similarity: 0.982 Similarity: 0.982
UTR: 5HSAA087149
Gene: QRICH1
MFE: -11.554
ENS: 0.813
Length: 73.
Predicted Ligands:
cobalamin - 15/20
fluoride - 3/20
homocysteine - 1/20
RS: URS0000C4AAC6_477641
MFE: -28.119
Ligand: cobalamin
Species: Modestobacter sp. 42H12-1 Cobalamin riboswitch
RS: URS0000C58DB8_1621259
MFE: -27.219
Ligand: cobalamin
Species: Streptomyces sp. NBRC 110611 Cobalamin riboswitch
RS: URS0000D8DD31_546874
MFE: -22.074
Ligand: fluoride
Species: Friedmanniella sagamiharensis Fluoride riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA087149 URS0000C4AAC6_477641 URS0000C58DB8_1621259 URS0000D8DD31_546874
Length 73. 73. 73. 74.
Similarity - 0.982 0.982 0.982
Ensemble Norm 0.813 - - -
MFE -11.554 -28.119 -27.219 -22.074
Ligands - cobalamin cobalamin fluoride
Gene QRICH1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7. 7. 2.005
Length SE - 0. 0. 1.
Lev Distance - 21. 21. 22.
UBS 8. 7. 7. 8.
BS 0. 0. 0. 0.
ILL 3. 1. 1. 2.
ILR 3. 2. 2. 3.
H 2. 2. 2. 2.
BL 3. 2. 2. 3.
BR 2. 2. 2. 3.
UN 0.123 0.137 0.137 0.054

Sequences

Field Description
UTR seq + 25 aaaggaggcucuggcgggcgacggaaggaacccuaaggacucugcaauATGAATAATTCCCTAGAGAACACCA
UTR dot + 25 …((.((.(((..(.(….).)..))).))))..(..(((((….((…..))….)))))..)….
RS 1 seq GAGGAAGCCCGGUGAGACUCCGGCGCGGUCCCGCCACUGUGAGCCGGCUCCCCCGCCGGUGAGUCAGGAACUC
RS 1 dot (.(((.((((((…….)))).))..))))….((((..((((((……))))))..).)))……
RS 2 seq GAGGAAGCCCGGUGAGACUCCGGCGCGGUCCCGCCACUGUGAACCCGGCCCAGGCCGGGUGAGCCAGGAACUC
RS 2 dot (.(((.((((((…….)))).))..))))….((((..((((((……))))))..)).))……
RS 3 seq UUGUCCCCUGGCGAUGGAUUCCGCCGGAGGUCGCGACCUCGAACCGCCGCACGGCUGAUGACUCCUGGACGCUC
RS 3 dot ..(.((.((((((……..)))))).)).)(((.((..((..((((….)))….)..))..)).)))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table