Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA087150 Similarity: 0.965 Similarity: 0.963 Similarity: 0.961
UTR: 5HSAA087150
Gene: QRICH1_0
MFE: -26.819
ENS: 0.655
Length: 140.
Predicted Ligands:
SAM - 9/20
cobalamin - 3/20
TPP - 3/20
RS: URS000073D46C_1032505
MFE: -27.304
Ligand: glucosamine
Species: Fusobacterium sp. OBRC1 glmS glucosamine-6-phosphate activated ribozyme
RS: URS0000D8BA00_1109743
MFE: -63.
Ligand: SAM
Species: Streptomyces sp. SCSIO 03032 SAM riboswitch (S box leader)
RS: URS0000C48DC6_408015
MFE: -60.
Ligand: SAM
Species: Streptomyces xiamenensis SAM riboswitch (S box leader)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA087150 URS000073D46C_1032505 URS0000D8BA00_1109743 URS0000C48DC6_408015
Length 140. 139. 140. 139.
Similarity - 0.965 0.963 0.961
Ensemble Norm 0.655 - - -
MFE -26.819 -27.304 -63. -60.
Ligands - glucosamine SAM SAM
Gene QRICH1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.010 0.001 4.001
Length SE - 1. 0. 1.
Lev Distance - 45. 50. 50.
UBS 8. 7. 8. 9.
BS 0. 0. 0. 0.
ILL 3. 3. 3. 2.
ILR 4. 3. 4. 4.
H 3. 4. 3. 3.
BL 0. 0. 0. 1.
BR 0. 0. 0. 1.
UN 0.121 0.223 0.150 0.151

Sequences

Field Description
UTR seq + 25 cgagccgcuccauacccuaggauccacuauccgcucuagcggccagaagcgcggccaccuuccccugcugaagcguucacuuuaauuuuggccggaacccuaaggacucugcaauATGAATAATTCCCTAGAGAACACCA
UTR dot + 25 .((((…………..((((…..))))))))…((((((((((((((((………..)))…))))………)))))))))………(..(((((….((…..))….)))))..)….
RS 1 seq UAUGUAAAAGAAGCGCCAGAACUCUUUUUAGAGUUGACGAGGAUUGGAAUUAUCGAAGUUUUCGGCGGAUAUUCCAAAGGUGGUUACAACCAUUAUCAACAAAAACACAGAGCAAUUUGUGUAACAAAGAGAUAAUAGU
RS 1 dot ……………….((((((….))))))……..(((((((..(((..(….)..)))..))))))).(((…….)))((((((…….(((((((….)))))))……..))))))…
RS 2 seq CGCUCAUCCAGAGGGGCAGAGGGAACGGCCCGUAGAAGCCCCGGCAACCCUUCCGCCGGUCUCGUGACGUACACGAGGUCACCGGUGGGGAAGGUGCCAAUUCCGUCCUGCGGCGAGAUACGUCGCGGGGAAGAUGAGGA
RS 2 dot …………(((((…(((…..)))……)))))((((..((((((((((((((((((…..))))))…))))))..))))))))))…((..((((((((((…..))))))))))..))……
RS 3 seq AGCUCAUCCAGAGGGGCAGAGGGAACGGCCCGUUGAAGCCCCGGCAACCCUUCCGCCGGUCUCGUGACGAUGCGAGGCUCCCGGUGGGGAAGGUGCCAAUUCCGUCCUGUGGCGAAAUCCGUCACGGGGAAGAUGAGGG
RS 3 dot …………(((((((.(((…..))).))…)))))((((..(((((((((((((((((……))))))…)))))..))))))))))…((..((((((((((…..))))))))))..))……

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table