Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA087162 Similarity: 0.977 Similarity: 0.977 Similarity: 0.976
UTR: 5HSAA087162
Gene: QSOX1
MFE: -46.619
ENS: 0.795
Length: 100.
Predicted Ligands:
TPP - 5/20
glycine - 4/20
SAM - 4/20
 RS: URS0000C0F42D_1423724
MFE: -19.116
Ligand: purine
Species: Lactobacillus apodemi DSM 16634 = JCM 16172 Purine riboswitch
 RS: URS00019E8E60_2038389
MFE: -37.606
Ligand: glycine
Species: Rhizobium sp. EC-SD404 Glycine
 RS: URS0000D79F30_1798311
MFE: -37.224
Ligand: TPP
Species: Gemmatimonadetes bacterium RBG_16_66_8 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA087162 URS0000C0F42D_1423724 URS00019E8E60_2038389 URS0000D79F30_1798311
Length 100. 99. 99. 100.
Similarity - 0.977 0.977 0.976
Ensemble Norm 0.795 - - -
MFE -46.619 -19.116 -37.606 -37.224
Ligands - purine glycine TPP
Gene QSOX1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 10. 8.001 11.
Length SE - 1. 1. 0.
Lev Distance - 25. 26. 27.
UBS 9. 9. 8. 9.
BS 0. 0. 0. 0.
ILL 1. 0. 2. 1.
ILR 4. 2. 3. 1.
H 2. 2. 2. 3.
BL 4. 5. 2. 4.
BR 2. 4. 3. 3.
UN 0.040 0.061 0.010 0.030

Sequences

Field Description
UTR seq + 25 ggaggcaggcggugccgcggcgccgggacccgacucauccggugcuugcgugugguggugagcgcagcgccgaggATGAGGAGGTGCAACAGCGGCTCCG
UTR dot + 25 …((((…..)))).(((.((((.(.(((..((((((((((((.(((((……….))))))))))..)))))))..)).)…)..)))).)))
RS 1 seq UAUUCUUAAGUAAGAGUUACUUGUAUAAUGUCAUAAUCUGGUUGACGAGUUUCUACCCAAGACCGUAAAUCUUGGACUAUGAGUACAAUAUGCAUGGCG
RS 1 dot .((((((….))))))..(.((((((.(((((((.(((((((.(((.((((…….))))))).))))..))).)))))…)).)))))).)…
RS 2 seq GGCCACUCGAUGGGAGAAGCCGGACCCUGCUUGGGAGCACCGGUGCCGAAGGAGCAAUCGCCCCCGGAAACUCUCAGGCAAAAGGACCAUCGGGUACCG
RS 2 dot .((..(((…..)))..))(((((((((((((((((..((((.(.(((……..))).).))))…))))))))))………..)))).)))
RS 3 seq CGUGGCAGGCAGGGGUGCUCACUCGUUCGGGUGGGCUGAGAUCAUACCCUUUGAACCUGAUCCGGUUCGCACCGGCGGAGGGAGCCAUGACGAAAGUCGA
RS 3 dot (.((…..)).).(.((((.(((..((((((((((((.(((((………….))))))))))))).))))..))).))))).((((….)))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table