Detected as a riboswitch by 10 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA087277 Similarity: 0.975 Similarity: 0.970 Similarity: 0.969
UTR: 5HSAA087277
Gene: RAB11B
MFE: -60.357
ENS: 0.870
Length: 121.
Predicted Ligands:
cobalamin - 6/20
SAM - 4/20
molybdenum - 3/20
 RS: URS0000ABCC30_416591
MFE: -44.375
Ligand: molybdenum
Species: Thermotoga lettingae TMO Moco (molybdenum cofactor) riboswitch
 RS: URS0002315708_649638
MFE: -46.290
Ligand: cobalamin
Species: Truepera radiovictrix DSM 17093 Cobalamin riboswitch
 RS: URS0000D69391_12908
MFE: -26.391
Ligand: GMP
Species: unclassified sequences c-di-GMP-I-UAC riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA087277 URS0000ABCC30_416591 URS0002315708_649638 URS0000D69391_12908
Length 121. 121. 120. 122.
Similarity - 0.975 0.970 0.969
Ensemble Norm 0.870 - - -
MFE -60.357 -44.375 -46.290 -26.391
Ligands - molybdenum cobalamin GMP
Gene RAB11B - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7.003 8.002 15.002
Length SE - 0. 1. 1.
Lev Distance - 31. 36. 34.
UBS 9. 8. 11. 9.
BS 0. 0. 0. 0.
ILL 1. 2. 2. 2.
ILR 2. 2. 3. 4.
H 2. 2. 2. 2.
BL 5. 3. 4. 2.
BR 4. 3. 5. 3.
UN 0.174 0.116 0.125 0.213

Sequences

Field Description
UTR seq + 25 cauucaaccgccgcucugcgcggcgccggcuccgcccccgucggguguuugugguggggcugcggagucgccgaucccgccggaagcgccaggacaATGGGGACCCGGGACGACGAGTACG
UTR dot + 25 ……..((((((…..))))))((((.(((.((…(((.(((((((.(((((((((.(((….))).).)))))))).)))))))..)))…))))).))))………….
RS 1 seq UAAUUUGAAAACCUCCGAGCCUGGUUUUCUAAGGGCUCAUGCCUAUGAAUCCAGGCCGAUAGGGUCAAGAGGGAAACUUCUUGGCCUCCCGUGUUUGGAAAGGAGGGAUGGUUGUGUUGCU
RS 1 dot ……(((((((………)))))))..(.(((.(((.(((…..(((((((((…(((((((((((….)))))))))))..)).)))))))….))).)))))).)……
RS 2 seq CCUGGGCCGUAAGCUCAGAGCCGCGCACGUCUGGGGAAGUCCGGUGCGAGUCCGGCGCUGUCCCGCAACGGUAACGAGACCCCUCGAAGCCCGAUCGCCAGCCGUGACGCCUACACACCC
RS 2 dot .((((((…..))))))….(((((((.((((.((..((.(((.((((((((..(((((……)))))..)).)))…)))..))).)))).)))).)))).)))……….
RS 3 seq UAGAUACAAUGUAAACCUGGUGAAAAUCAGGGGCACAAAGCUAUAGGGUCUAAGAGGUCCCAGGGAACGGGGAUCACGUCCGGACGGAAAUAUCGGAAGCUUAUGACAGCCAGCUGCAAGGA
RS 3 dot ……………((((((….))))))(((.(((((((…((((((..((((((((.(….).))))))…)).))))…….))…))))).))…)))………..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table