Detected as a riboswitch by 19 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA087319 Similarity: 0.989 Similarity: 0.988 Similarity: 0.988
UTR: 5HSAA087319
Gene: RAB14
MFE: -7.925
ENS: 0.939
Length: 80.
Predicted Ligands:
zmp-ztp - 19/20
glycine - 1/20

 RS: URS0000C240ED_1262947
MFE: -16.663
Ligand: zmp-ztp
Species: Roseburia sp. CAG:45 ZMP/ZTP riboswitch
 RS: URS0000C3A43A_469618
MFE: -16.802
Ligand: zmp-ztp
Species: Fusobacterium varium ATCC 27725 ZMP/ZTP riboswitch
 RS: URS0000D7BA2E_1122155
MFE: -17.144
Ligand: zmp-ztp
Species: Lactonifactor longoviformis DSM 17459 ZMP/ZTP riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA087319 URS0000C240ED_1262947 URS0000C3A43A_469618 URS0000D7BA2E_1122155
Length 80. 80. 81. 79.
Similarity - 0.989 0.988 0.988
Ensemble Norm 0.939 - - -
MFE -7.925 -16.663 -16.802 -17.144
Ligands - zmp-ztp zmp-ztp zmp-ztp
Gene RAB14 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.013 2.014 2.018
Length SE - 0. 1. 1.
Lev Distance - 15. 15. 15.
UBS 2. 3. 3. 3.
BS 0. 0. 0. 0.
ILL 0. 0. 0. 0.
ILR 0. 0. 0. 0.
H 2. 3. 3. 3.
BL 0. 0. 0. 0.
BR 0. 0. 0. 0.
UN 0.537 0.425 0.420 0.405

Sequences

Field Description
UTR seq + 25 ggauauguugauuaaauauguauuuuaaauauuuaaguuuuuuuucuauaauuauATGGCAACTGCACCATACAACTACT
UTR dot + 25 ..(((((((…..)))))))……………………………(((((……..)))))……..
RS 1 seq AAACCGUUAUAUGACUGACGGAUAAGUGGAAAAACCACAUGAAGUAUAACGAAAACGAGCCGACCGUCUGGGCGAUGAAC
RS 1 dot …((((((……))))))….((((…..))))………………..(((………)))…….
RS 2 seq UAUCAGUUAUAUGACUGACGGAACGUGGAAUUAACCACAUGAAGUAUAACGAUGAUAAUGCCGACCGUCUGGGCAAAUAAG
RS 2 dot ..((((((….))))))……((((……))))………………..((((………))))……
RS 3 seq GGUUAGUUAUACGACUGACGGAAGUGGAAGUAACCACAUGAAGUAUAAUGAUAAUGAGCCGACCGUCUGGGCAAAGAGC
RS 3 dot .(((((((….)))))))….((((……))))………………..(((………)))…….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table