Detected as a riboswitch by 15 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA087385 Similarity: 0.966 Similarity: 0.964 Similarity: 0.964
UTR: 5HSAA087385
Gene: RAB27A
MFE: -18.231
ENS: 0.899
Length: 134.
Predicted Ligands:
cobalamin - 10/20
methionine - 3/20
molybdenum - 3/20
 RS: URS000231464F_644283
MFE: -50.962
Ligand: cobalamin
Species: Micromonospora aurantiaca ATCC 27029 Cobalamin riboswitch
 RS: URS000231E446_307121
MFE: -51.943
Ligand: cobalamin
Species: Micromonospora krabiensis Cobalamin riboswitch
 RS: URS0000C70D1D_40148
MFE: -46.090
Ligand: TPP
Species: Oryza glumipatula TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA087385 URS000231464F_644283 URS000231E446_307121 URS0000C70D1D_40148
Length 134. 136. 136. 134.
Similarity - 0.966 0.964 0.964
Ensemble Norm 0.899 - - -
MFE -18.231 -50.962 -51.943 -46.090
Ligands - cobalamin cobalamin TPP
Gene RAB27A - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 9. 9.001 7.006
Length SE - 4. 4. 0.
Lev Distance - 38. 40. 46.
UBS 6. 6. 6. 8.
BS 0. 1. 1. 0.
ILL 1. 2. 2. 2.
ILR 1. 2. 2. 1.
H 2. 3. 3. 2.
BL 2. 0. 0. 3.
BR 3. 2. 2. 2.
UN 0.246 0.228 0.221 0.172

Sequences

Field Description
UTR seq + 25 gagacucugcauacugaauaauaggugaaauaaggaaagacuuugagaagcaauaagaaauauaucugauuugaccuuguccauuaggugaacuacugaguucuucauuATGTCTGATGGAGATTATGATTACC
UTR dot + 25 ………………….((((.((((..(((……………………….))).)))).))))(.(((((((((((((((….)))))……..)))))))))).)………..
RS 1 seq CUGUCGCGACAACUGAACCACCGCGUGUACGUGCGGGGGAAGACCGGUCGAAAUCCGGCGCUGGCCCGCAACGGUAGGCCGCCCAGAGAAAUCUGCGGCGGCGAGCCCGAAUACCCGUCGUACGCGUGCAUCCGCU
RS 1 dot …………………((((((((((((((((……((((…….))))……))))))..(((..((((((((((….)))).))))))..)))((……)).))))))))))……..
RS 2 seq GUCGCGACAACUGAAACCAACACGCGUACGUGCGGGGGAAGACCGGUCGAAGUCCGGCGCUGGCCCGCAACGGUAGGCCGUCCAGGUGCAUCCUGCGGCGGCGAGCCCGAAUACCCGUCGUACGCGUGCAUCCGCU
RS 2 dot ………………..((((((((((((((((……((((…….))))……))))))..(((..((((((((((…..)))).))))))..)))((……)).))))))))))……..
RS 3 seq AUAGUUGCACCGGGGUGCCUGUAUUCUCAACGAUCUGUAGGCCUCUUGGCCCGGAUUGUUGUGAGUUGGGCUGAGAAAGUCCCUUUGAACCUGAACAGGAUAAUGCCUGCGAAGGGAGUGUGCACUUCUAUUUU
RS 3 dot …………….(((((.((((.((((((((((..((((….)))))))))))))).)))))))))..(((((.((((((((……..((((……)))))))))))).)……))))…..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table