Detected as a riboswitch by 15 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA087386 Similarity: 0.967 Similarity: 0.965 Similarity: 0.963
UTR: 5HSAA087386
Gene: RAB27B
MFE: -35.579
ENS: 0.888
Length: 136.
Predicted Ligands:
TPP - 12/20
molybdenum - 5/20
glutamine - 1/20
 RS: URS0000AB1674_903814
MFE: -21.083
Ligand: molybdenum
Species: Eubacterium limosum KIST612 Moco (molybdenum cofactor) riboswitch
 RS: URS0000BF1DB0_1330036
MFE: -31.647
Ligand: TPP
Species: Osedax symbiont Rs1 TPP riboswitch (THI element)
 RS: URS0000C26FB3_101091
MFE: -36.570
Ligand: TPP
Species: Choanephora infundibulifera f. cucurbitarum TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA087386 URS0000AB1674_903814 URS0000BF1DB0_1330036 URS0000C26FB3_101091
Length 136. 136. 135. 137.
Similarity - 0.967 0.965 0.963
Ensemble Norm 0.888 - - -
MFE -35.579 -21.083 -31.647 -36.570
Ligands - molybdenum TPP TPP
Gene RAB27B - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.003 17.001 7.005
Length SE - 0. 1. 1.
Lev Distance - 44. 39. 46.
UBS 8. 9. 11. 9.
BS 0. 0. 0. 0.
ILL 3. 2. 4. 2.
ILR 4. 4. 6. 4.
H 3. 3. 2. 3.
BL 2. 3. 3. 0.
BR 0. 0. 1. 1.
UN 0.140 0.191 0.111 0.066

Sequences

Field Description
UTR seq + 25 guggagcccgggaguuccagggcuugggaaggggaaggaaaccucucugaaaucugacaccugcucucccggcaaggaaacuucgcaggcugaccgaccaagaccaucacuATGACCGATGGAGACTATGATTATC
UTR dot + 25 ((((((.(((((((…((((..(((((..((((.(((…)))))))….)))))..))))..)))))))……..)))))).((……..))….(((((………)))))…………..
RS 1 seq UUAUAUAACAAGCUCUGAUGGACUUAACCUAAAAACGGAUUGCCCAAAAUCAUUUGUUCAUGGUUUUGCCACGAUAGGGUACUGUUGGAAACGGCUUUACCUUCUGUAUUUGAAAAGGAGUAAAAAAAUGAGAAAA
RS 1 dot ………..((((((.(((.(..((((….((((((((……))))…))))…))))..))))…))))))…((((….))))((((.(((((……….)))))))))…………
RS 2 seq CUGAUCUUGUCGGGGCGCCCCGUCGCUUAAUGCAGCUAGCUAGAAUUAAGUAGACCAAGGCUGAGAUUGGCUGUGCCAUGUCCCGUUGAACCUGAUCAGGUUUACACCUGCGUAGGGAACAAGUAAUGCAAAUAG
RS 2 dot ((((((..(((((((((…((..((.((((.(((((.((((……..))).)…)))))..))))))..))…)))))))….))..))))))((((…(((….)))))))……………
RS 3 seq AUCUGCAUCAAGGGGUGCCUUUCAAUCAUUCUCUAUCUUCUUUUGAAGAAGAAUUGGUUGUUAAACCGGCUGAGAAUUUAAACCCUCAUUUAGCGGACCAGGAUAAUGCCUGCGUCGCGAUGAUGUGAUGAUGAACU
RS 3 dot .(((((…..(((((((((((((((((((((…(((((….)))))))))).)))))..)))..)))………..)))))……))))).((((……))))((((((……))))))…….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table