Detected as a riboswitch by 3 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA087471 Similarity: 0.955 Similarity: 0.950 Similarity: 0.950
UTR: 5HSAA087471
Gene: RAB35
MFE: -74.152
ENS: 0.685
Length: 170.
Predicted Ligands:
Mg2+ - 9/20
TPP - 5/20
lysine - 3/20
RS: URS0000C867D5_913774
MFE: -45.741
Ligand: TPP
Species: Oidiodendron maius Zn TPP riboswitch (THI element)
RS: URS0000C6968D_1043003
MFE: -49.385
Ligand: TPP
Species: Aureobasidium melanogenum CBS 110374 TPP riboswitch (THI element)
RS: URS0000ABD098_595494
MFE: -67.276
Ligand: lysine
Species: Tolumonas auensis DSM 9187 Lysine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA087471 URS0000C867D5_913774 URS0000C6968D_1043003 URS0000ABD098_595494
Length 170. 171. 167. 171.
Similarity - 0.955 0.950 0.950
Ensemble Norm 0.685 - - -
MFE -74.152 -45.741 -49.385 -67.276
Ligands - TPP TPP lysine
Gene RAB35 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 11.008 23.004 13.001
Length SE - 1. 9. 1.
Lev Distance - 54. 43. 60.
UBS 10. 10. 9. 11.
BS 5. 3. 3. 4.
ILL 4. 4. 0. 4.
ILR 2. 3. 2. 1.
H 3. 2. 2. 2.
BL 7. 5. 6. 7.
BR 5. 4. 5. 8.
UN 0.047 0.135 0.108 0.070

Sequences

Field Description
UTR seq + 25 agggggagcggagggagguguuucugucaguuccggcuguuuguucgggaaguggauccgccgcugccggagcagcccgaagggagcugcggaucgcgaggccaguaccgaccccgcccgcccgcgcgcaccgcccccgcccgccATGGCCCGGGACTACGACCACCTCT
UTR dot + 25 .((.((.((((.(((.(((((.((((.(((((((((((((…(((((..(((((…..))))).)))))))))))…..))))))))))).((((.(((..((………))..))))))).))))).))))))))).)).(((..((……)).)))…..
RS 1 seq UAAAGCAUGAACCGGUGUUCGUUCCCAGCGUCAAGCACAACUCUUCAUCCACCAUCGUCCACGAUGAGAUGAGAAGUAUUGUUGACACAUCCUGGGUUCGUUCUGAGAUCAUACGGUUAAGAUGAACUUGAUCUGGAUAAUACCAGCGAAAGGAUCAUGCACUCUCCCGUC
RS 1 dot ….((((((.((((((((((..(((((.(((.((((..(((.((((((…(((((….))))).)))))).)))..)))))))…..)))))..)).(((.((((((…((((……))))))))))))).))))))…….)).))))))………..
RS 2 seq UGAUGCAUGAGCGGGUGUUCGAUAGCGAGCUUCUGUCUGCCAACCCAUUGAUCUUUGAUCAUGGACAUUGGUGUCAGAACUGUAUCGCCUCGCUAUCGUUCUGAGAUUAGACCGCCUGAACUUGAUUUCUGGAUAAUACCAGCGAAAGGAUCAUGCAUACCGAACCA
RS 2 dot ..((((((((((.((((((((((((((((((((((.(.(((((.(((.(((((…))))))))…)))))).)))))…….)).)))))))))(((.((((((((………..)))))))).))).)))))).))…….))))))))………
RS 3 seq GGGGCCAGAAGAGGAGCGUUACCCAGGUCGCUGACAACAGGUGCCAAAACCGUUGAAGGUCAGUCAGGGGGUGUAACGCCGAGAUAACCAUCAUCUUUGGCGAUGUUGUUUGUCGGCUGCGGGGGCUGAAUCCUCCGGGCUGUCACCUGAGGGUGGAGCGCUUCUGGCUGG
RS 3 dot ..(((((((((….((.((((((((((.((.(((((((..(((((((…(.(((.(((..(((..((.((…)).))..))).))).))).)))))))).))))))).))(((((.((((((……)))))))))))..))))..)))))).)).)))))))))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table